ID: 1021243493

View in Genome Browser
Species Human (GRCh38)
Location 7:18233887-18233909
Sequence CTGTAGGAAACTTGGCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021243490_1021243493 3 Left 1021243490 7:18233861-18233883 CCACATTGGAGAGCTTTCAAGAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1021243493 7:18233887-18233909 CTGTAGGAAACTTGGCAAATAGG 0: 1
1: 0
2: 3
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021243493 Original CRISPR CTGTAGGAAACTTGGCAAAT AGG Intronic
903390891 1:22963071-22963093 CAGGAGGAAACTGGGCATATGGG - Intronic
908496964 1:64704097-64704119 CACCAGGAAATTTGGCAAATAGG + Intergenic
908590997 1:65633198-65633220 CTGTTGGGAAGTTGGCACATTGG - Intronic
908883257 1:68758092-68758114 GTTTAGGAAAAATGGCAAATAGG + Intergenic
916988650 1:170218523-170218545 GGTTAGGAAACTTGGCAAAGTGG + Intergenic
917215405 1:172673046-172673068 CTGTTGGAAATGTGGCAAAGAGG - Intergenic
917802446 1:178582718-178582740 CTGTAGGATATGTGGCAGATTGG + Intergenic
920840480 1:209549786-209549808 CTGTAGGGGGCTTGGCCAATGGG - Intergenic
921564113 1:216695427-216695449 CTGAAGGAAACTGGGTAAACAGG + Intronic
1069032612 10:63613487-63613509 CTGTAGAAAAATTGGAAACTGGG - Intronic
1070986723 10:80696004-80696026 CTGTCGTAACCTTGGCAGATGGG + Intergenic
1073410336 10:103336479-103336501 CTGTAGAATACTTGGTACATGGG + Intronic
1074281491 10:112055873-112055895 CTGCAGGCAACATGGCAAAGTGG - Intergenic
1076486488 10:130822731-130822753 CTGTTGTAATCATGGCAAATAGG - Intergenic
1077440403 11:2566199-2566221 CTGGAGGACCCTTGGCAAAGGGG - Intronic
1079053913 11:17188654-17188676 CTGTAGGAGAGTTGGTAGATGGG - Intronic
1080271046 11:30451100-30451122 CTGTAGGGGTCTGGGCAAATCGG + Intronic
1083112282 11:60423064-60423086 CTGTAAGTCACTTGGCAAATTGG + Intergenic
1086254102 11:84854026-84854048 CTGTAGCAAACTAGGTCAATGGG - Intronic
1086857230 11:91879320-91879342 CCTTAGTAAATTTGGCAAATGGG + Intergenic
1087615797 11:100485896-100485918 TTGTAGGAAAAATGGCAGATAGG + Intergenic
1088214099 11:107488881-107488903 ATGTTGGAAACTGGGCATATAGG + Intergenic
1090091359 11:123701246-123701268 CTGTATGATTCTGGGCAAATCGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091952506 12:4606680-4606702 CTGTAGGAAATTTGAAACATAGG - Intronic
1093402913 12:18768150-18768172 CTTTAGGAAACTTGTAAAATTGG - Intergenic
1093557189 12:20490422-20490444 CTGGAGGAAACTTGTAATATTGG + Intronic
1093720426 12:22436578-22436600 CTGTAGGGATCATGGCAGATGGG + Intronic
1094738907 12:33265830-33265852 CTTTGGGAAACTTTCCAAATAGG - Intergenic
1095882901 12:47157422-47157444 CTGTAAGAAACTTTAAAAATTGG + Intronic
1096411790 12:51382364-51382386 ATGCAGGAAACTCAGCAAATGGG + Intronic
1096430998 12:51542678-51542700 CTAAAGGAAACATGGCAGATGGG + Intergenic
1096646410 12:53039624-53039646 CTGCAGGAAAGATGGCAAAAAGG + Exonic
1101727931 12:107403380-107403402 CCATAGGAAGCTTGGCAGATGGG + Intronic
1101875693 12:108595794-108595816 CTGTAGGAACCTTTGCTAACAGG - Intronic
1102407906 12:112690143-112690165 TTGTAGAAAAGTTGGAAAATTGG + Intronic
1106861512 13:33913790-33913812 CTGTAGTAAACATGGCAACAAGG - Intronic
1108204708 13:48075907-48075929 CTCTAGAAAAATTGGAAAATAGG - Intronic
1109513412 13:63408644-63408666 CTGGAGGAAATTGGGCTAATGGG + Intergenic
1116757956 14:48971425-48971447 CTGGGGGAAAGTTGTCAAATAGG + Intergenic
1120110519 14:80549242-80549264 CAGTGGGAAACTTGGCAGAACGG + Intronic
1120992300 14:90388274-90388296 CTGTGGGAACCTTTGCATATGGG - Intergenic
1121252710 14:92511735-92511757 CTGTAGGAATCTGGGCAGAGGGG + Intergenic
1123672363 15:22672013-22672035 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124150746 15:27175673-27175695 TGGTAGGAAGCATGGCAAATGGG + Intronic
1124324409 15:28745306-28745328 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124528288 15:30478348-30478370 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124770369 15:32529355-32529377 CTTGAGGGAAGTTGGCAAATAGG - Intergenic
1128019677 15:64379717-64379739 CAGTAGGAAATTTGGCAGACAGG - Intronic
1129570688 15:76681245-76681267 CTGTAGGAAATTTGAAAATTGGG - Intronic
1130732430 15:86511153-86511175 CTGAAACAAACTTGTCAAATGGG + Intronic
1133250648 16:4478303-4478325 CTGTTGAAAACTTGTAAAATTGG + Intronic
1134891497 16:17845366-17845388 CTGTGGGCACCTTGGAAAATGGG - Intergenic
1134891626 16:17846307-17846329 CTGTGGGCACCTTGGAAAATGGG - Intergenic
1135006595 16:18829229-18829251 AGGTAGGAAACTTGAAAAATGGG - Intronic
1139745182 16:69068419-69068441 CTGTGTGAACCTGGGCAAATTGG + Intronic
1149084488 17:52698838-52698860 CTGTAGGAAATTTGGCTAAACGG - Intergenic
1149966401 17:61168904-61168926 CATTAGGAAACTAGGCAAAATGG - Intronic
1150200722 17:63354227-63354249 CAGTAGGAAGCTTGGCACCTTGG - Intronic
1150926724 17:69540107-69540129 CTCTAGGAAACAATGCAAATGGG - Intronic
1152682338 17:81675183-81675205 TTGTAGGAAAGTTGACAACTAGG - Intergenic
1157767915 18:50315997-50316019 CTGCAGGAAACTTATTAAATGGG - Intergenic
1158175985 18:54656322-54656344 CTCTATGAAACTTGCTAAATAGG - Intergenic
1158561654 18:58519099-58519121 CTGCAGGAAAACAGGCAAATGGG + Intronic
1159711832 18:71769888-71769910 CTTTTGGAAATTTGGCAAAATGG - Intronic
1159884235 18:73889042-73889064 TTCTATGAAACTCGGCAAATGGG - Intergenic
1160172248 18:76564789-76564811 CAGCAGGAATCTTGCCAAATCGG - Intergenic
1161416758 19:4151604-4151626 CTGTTGGAAGTTTAGCAAATAGG - Intergenic
1163235580 19:16028639-16028661 CTGAAGAAAACTGGGCAAAGGGG + Intergenic
1164215234 19:23138913-23138935 CTGTAGGAAAATAAGCAAATAGG + Intronic
926869719 2:17400770-17400792 CTCTAGCAAACTAAGCAAATTGG + Intergenic
927356073 2:22174496-22174518 ATGCAGGAAACTTTGCAGATTGG - Intergenic
929134651 2:38611947-38611969 CTGTAGGAGTCTTGGCAAATTGG + Intergenic
930513133 2:52371388-52371410 TTATAGGATACTAGGCAAATAGG - Intergenic
931487772 2:62710214-62710236 CTGTATGAAAGTTGGCAAGTTGG + Intronic
932049596 2:68385504-68385526 CAGTAAGAAATTTGGCTAATGGG - Intronic
934755696 2:96823260-96823282 CTGTAGGAAACCTGCCAAAGGGG + Intronic
935201192 2:100857949-100857971 CTGTAGGCAAGTTGGAAAACTGG + Intronic
936742217 2:115526440-115526462 TTGTAGAAAATTTTGCAAATGGG + Intronic
936896682 2:117435571-117435593 CATTAGGAAATGTGGCAAATTGG + Intergenic
940541691 2:155028469-155028491 CAGAAGGAAACTTGGAAATTAGG - Intergenic
941161038 2:162034468-162034490 CTGTAAGAAATTTGGAAAAGGGG - Intronic
941519804 2:166526919-166526941 TTGTAGCAAGCTTGGAAAATTGG + Intergenic
941788676 2:169526523-169526545 CTGTCAGAAATTTAGCAAATAGG - Intergenic
943687731 2:190836819-190836841 CTGAAGGAAATTTGGGAATTAGG + Intergenic
944540900 2:200752628-200752650 TTCTTGCAAACTTGGCAAATGGG - Intergenic
946602761 2:221370313-221370335 CTTTTGGACACTTAGCAAATAGG - Intergenic
948180703 2:235977789-235977811 GTGGAAGCAACTTGGCAAATGGG + Intronic
1169871760 20:10255193-10255215 CTTTTGGAAACTTGGCAGGTTGG - Intronic
1170495679 20:16922486-16922508 CAGTAGGAAAACAGGCAAATGGG - Intergenic
1172819796 20:37721551-37721573 CTGAAGTAAATTTGGCAAAATGG - Intronic
1173556291 20:43968402-43968424 TTTAAGGAAACTTAGCAAATAGG - Intronic
1175747009 20:61464140-61464162 TTCTAGGAAACTTGGCACGTTGG + Intronic
1179610991 21:42549924-42549946 CTGTTGGAAACTTGGGTAATGGG - Intronic
950809833 3:15640854-15640876 CTGTAGAAAATTTGGAAAACGGG - Intronic
951724868 3:25746464-25746486 TTGTAGAAAATTTGGAAAATAGG - Intronic
952445931 3:33380598-33380620 GTGTAGGGAACATGGCAACTGGG - Intronic
953948816 3:47172015-47172037 CTGTAGCAGTATTGGCAAATGGG + Intergenic
957222722 3:77404696-77404718 TTATAGGAAATTTGGCAAAATGG + Intronic
958153657 3:89725249-89725271 CACTAGGAAACCTGGCAATTTGG + Intergenic
960288702 3:115858414-115858436 ATTTAGGAAACTTGCTAAATTGG + Intronic
960568461 3:119161200-119161222 CTTTAAGAAACATGGCAAAACGG - Intronic
961721723 3:128901477-128901499 CTGTTGGGAAATTGGCAAAATGG + Intronic
962133008 3:132702430-132702452 CTGGGGAAAACTTGGGAAATAGG - Intronic
962176832 3:133163849-133163871 CTGTGGGAAACTTGGTAGCTAGG - Intronic
963257355 3:143159065-143159087 TTGTAGGAAACATGGAAAAGGGG - Intergenic
964262720 3:154857619-154857641 CTGAAAAAAACCTGGCAAATTGG - Intergenic
970026640 4:11630925-11630947 CTGAAGGAAACTTGGAGAATGGG + Intergenic
977679993 4:99787768-99787790 CTGAAAGAAACCTTGCAAATAGG - Intergenic
981624005 4:146736062-146736084 CTGGAGGAAACATAGCAAACTGG - Intronic
981921252 4:150087104-150087126 CTGTTGAAAACACGGCAAATAGG - Intronic
983152399 4:164300875-164300897 CTGAATGAGACTGGGCAAATGGG - Intronic
983352554 4:166610576-166610598 ATGTGGGAAACATGGAAAATTGG + Intergenic
984006554 4:174317737-174317759 CTGTTGGAAACATTCCAAATGGG + Intronic
984927820 4:184821956-184821978 CTGGAGAAAATTTGGGAAATAGG - Intronic
986984409 5:13483645-13483667 CACTAGGAAAATTGGCAAAATGG + Intergenic
987005113 5:13702885-13702907 CTGTAGGTTACTTGGCTAAATGG - Intronic
990276525 5:54202807-54202829 CTTTAGGAAACCTTGTAAATAGG - Intronic
990491782 5:56309916-56309938 CTGTAGGAAATAAGGAAAATAGG + Intergenic
992417889 5:76570110-76570132 CTGCAGAAAACCTGGAAAATAGG - Intronic
992598692 5:78373465-78373487 ATGTAGGAAAGTTGCCACATGGG + Intronic
993061796 5:83047532-83047554 CTGCAGGACACTGGGCAAACTGG - Intergenic
995530398 5:113086440-113086462 CTGTAGGTAACTTGGGGAAAAGG - Intronic
996452835 5:123646479-123646501 CTTTAAGAAACTTGGCGACTGGG - Intergenic
997031076 5:130129087-130129109 CTTGAGGAAACTTGGCACATAGG - Intronic
997521893 5:134528241-134528263 CAGTAGGACATTTGGCAAAAGGG + Intronic
998228099 5:140342281-140342303 CAGTAGGAAACATGGCAGAGTGG - Intronic
998334753 5:141361582-141361604 GAGTAGGAAACTTGGCCACTGGG - Exonic
1000431110 5:161153411-161153433 CTGTAGAAATCTTCTCAAATTGG + Intergenic
1001770194 5:174289843-174289865 CTGAAGAAAACTAGACAAATGGG - Intergenic
1004424516 6:15498293-15498315 CTGTTGGAAACTTGTCACAGTGG + Intronic
1004445892 6:15697926-15697948 TTGTAGAAAATTTGGAAAATAGG - Intergenic
1004975086 6:20956305-20956327 CTGTGTCAAACTAGGCAAATGGG + Intronic
1006729018 6:36221719-36221741 CTTTAGAAAATTTGGCAAAGAGG + Intronic
1007420635 6:41717104-41717126 CAGCAGGAAACTAGGAAAATAGG + Intronic
1008072509 6:47112165-47112187 ATGTAGGAAAATCAGCAAATTGG - Intergenic
1010960024 6:82135319-82135341 CTGTAAAACATTTGGCAAATAGG - Intergenic
1011202618 6:84853673-84853695 CTGTAGAAAACTTGGAAAATAGG + Intergenic
1014006074 6:116419609-116419631 CTGCAGCAAAGCTGGCAAATGGG + Intronic
1015400665 6:132784641-132784663 CGGTAGGCAATTTGGCAATTTGG + Intronic
1021243493 7:18233887-18233909 CTGTAGGAAACTTGGCAAATAGG + Intronic
1021533064 7:21671712-21671734 CTGTAAGAAACTTGAAAAAGAGG - Intronic
1021862280 7:24917956-24917978 CTGAAGGAATCTTGGTAAATGGG - Intronic
1024415593 7:49101831-49101853 CTAAAGGAAAATTGGTAAATTGG - Intergenic
1025097776 7:56110505-56110527 CTGTAGAAAAACTGGAAAATAGG - Intergenic
1025991479 7:66500588-66500610 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1027213744 7:76170446-76170468 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1028798384 7:94931371-94931393 CTGTACGACACTGGGCCAATAGG - Intronic
1033961578 7:146919953-146919975 ATGGAGGAAAATTGGCAGATAGG - Intronic
1035859168 8:3009476-3009498 CTGAAGAAAAGTTTGCAAATTGG - Intronic
1036719185 8:11156938-11156960 CAGTAGGAAACCTGGCAAACAGG + Intronic
1038954239 8:32450055-32450077 CTATAGGAAACCTGGCAACCCGG + Intronic
1039080792 8:33732467-33732489 GTGTGGGGAACTTGGCAAATGGG - Intergenic
1039350698 8:36760712-36760734 CAGTAGGAAAATTGGCTATTTGG - Intergenic
1039378509 8:37061781-37061803 TGGTGGGAAACTTGGCAAACAGG - Intergenic
1041464459 8:58144974-58144996 CTATAGAAAACTTGGGTAATAGG - Intronic
1042092814 8:65177634-65177656 CTTTAGGAAACTTGGCTGCTTGG + Intergenic
1042447512 8:68903616-68903638 CTGTTAGAAACTTGGCTAACTGG + Intergenic
1044371310 8:91414472-91414494 CCGACGGAAACTTGGCAAAGTGG + Intergenic
1047349872 8:124063697-124063719 CTGTTGGAAAGTCAGCAAATGGG + Intronic
1052705179 9:31986595-31986617 CTGGAGGTAATTTTGCAAATTGG + Intergenic
1053023044 9:34708955-34708977 CTGTAGGAACCTTGGCATCTCGG + Intergenic
1056487608 9:87074896-87074918 TGTTAGGAAATTTGGCAAATTGG + Intergenic
1056555658 9:87685163-87685185 CTGTAGGAAAGTTGGCAGATAGG - Intronic
1057483611 9:95464483-95464505 CTGAAGGAAAATGGGCAATTGGG - Intronic
1057646318 9:96877988-96878010 TTGTAGTAAGCTTGGCAACTTGG + Intergenic
1058134995 9:101297105-101297127 TTGTAGGATAATGGGCAAATTGG + Intronic
1058603987 9:106701416-106701438 CTGTTTTAAACTTGGAAAATTGG + Intergenic
1060461930 9:123864511-123864533 CTGATGGACACTTGGTAAATGGG + Intronic
1186307824 X:8283181-8283203 ATGTAAGAAACATGGAAAATAGG - Intergenic
1186584712 X:10860455-10860477 CTCTTGGAAACTAAGCAAATAGG - Intergenic
1187595725 X:20770813-20770835 CTGAAGAAAAGTTGACAAATTGG + Intergenic
1188133159 X:26462872-26462894 GTGTAGTAAACATGGTAAATGGG - Intergenic
1189203453 X:39217555-39217577 CTCTAAGAAACGTGGCAAAATGG + Intergenic
1191897648 X:66010572-66010594 CTGGAGGAAACCTGGCAAAGAGG - Intergenic
1192469858 X:71388581-71388603 TTGTAGGAAACTTAGCAGCTGGG + Intronic
1195329352 X:103784617-103784639 GTGGAGGAAACTTTGGAAATTGG - Intronic
1195611315 X:106870488-106870510 CTTTAGGAAAGTTGGGAACTAGG - Intronic
1198503883 X:137281750-137281772 CTCAAGGAAAATTGGCAATTAGG - Intergenic
1198796194 X:140397989-140398011 GTGTTGGAAACCTGGCAAAACGG + Intergenic
1200329345 X:155279995-155280017 ATGCAGAAAACTTGGCAAAGAGG + Exonic
1201067041 Y:10106814-10106836 CTGTAGCAAACCTGGCACTTTGG - Intergenic