ID: 1021243822

View in Genome Browser
Species Human (GRCh38)
Location 7:18237238-18237260
Sequence CATGATTAGAAGTTATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021243822 Original CRISPR CATGATTAGAAGTTATTTTT AGG Intronic
900005374 1:42976-42998 CATTTTTACAAGTTATTTTATGG - Intergenic
901909402 1:12443491-12443513 CTTGATTAGAGAGTATTTTTTGG + Intronic
902106992 1:14046073-14046095 GATGATTAAAGGTAATTTTTTGG - Intergenic
902827127 1:18983498-18983520 TGTGAACAGAAGTTATTTTTTGG - Intergenic
904374969 1:30074972-30074994 CAAGATTAGAAATTAGTTTAGGG + Intergenic
905743933 1:40397194-40397216 GATGATTTGCAGTAATTTTTAGG - Intronic
906011516 1:42531458-42531480 CCTGATTAAACATTATTTTTGGG + Intronic
907185898 1:52608860-52608882 ATTGATAACAAGTTATTTTTTGG - Exonic
907381039 1:54089205-54089227 GCTGATTAGAAGTTATTTAATGG + Intronic
908974110 1:69877151-69877173 CATGGTTAGACTTTATTTTCTGG + Intronic
909054681 1:70807144-70807166 CAGCCTTAGAGGTTATTTTTTGG + Intergenic
910914161 1:92271601-92271623 CATGATTAAAAATCATTTTGGGG + Exonic
911747055 1:101451805-101451827 CACAATTAGAAGTTATGGTTAGG - Intergenic
911782067 1:101893486-101893508 CATCATGAGATGTTATTTTCTGG - Intronic
912025421 1:105163986-105164008 CATCATTACACGTTATTTATTGG + Intergenic
912069408 1:105789984-105790006 CATTATTATAATTTATTTTCAGG - Intergenic
912462811 1:109847953-109847975 CATGATTCAAAGTGATTTATAGG - Intergenic
912891728 1:113540099-113540121 CATCATTAAAAGTAATGTTTTGG - Intronic
915872511 1:159575951-159575973 AATGAATAGAATTTATTTCTTGG - Intergenic
916961707 1:169895628-169895650 CAAGATTAGAAATTATGGTTTGG + Intergenic
916971497 1:170022833-170022855 TATTATTAAAAGTTATTTTCTGG - Intronic
917013248 1:170499210-170499232 AATAATTAGAAATTATTTGTTGG - Intergenic
917653550 1:177103263-177103285 GATGATGTGAAGTTATATTTGGG + Intronic
918530632 1:185517244-185517266 CATATTTTGAAGTAATTTTTAGG - Intergenic
918876330 1:190049067-190049089 CATGCTAATAAGTTATGTTTTGG - Intergenic
918897318 1:190364737-190364759 CATTATTAAAATTTATTTTATGG - Intronic
919388726 1:196954676-196954698 CAAGATTTGAGGTTTTTTTTTGG - Intronic
919712487 1:200741160-200741182 AATGATTTGAATTTGTTTTTGGG + Intronic
920034548 1:203057332-203057354 CTTGATTGGAACTTATTTCTGGG + Intronic
922330134 1:224567599-224567621 CATCATCACAAGTTATATTTAGG - Intronic
923772405 1:236948977-236948999 TATGATTAGAAGAGATTTCTCGG - Intergenic
1063765691 10:9137739-9137761 CATGATTAAAAAGTATTATTTGG + Intergenic
1063774182 10:9241999-9242021 CATTATTAGAATTAACTTTTTGG + Intergenic
1064310356 10:14206957-14206979 CAAGATTACAAATTATTTTAAGG - Intronic
1064555746 10:16545697-16545719 CATGATTAGAAGATCTTTGAAGG - Intergenic
1064667617 10:17672862-17672884 AATGATAAGTAGGTATTTTTAGG + Intronic
1065430931 10:25654636-25654658 CAAGATTAGAAATTATGTTCTGG - Intergenic
1065507577 10:26444621-26444643 GATGATTAGAAGTTCAATTTTGG + Intronic
1065601068 10:27369328-27369350 CATGATTACACTTTAATTTTTGG - Intergenic
1065656047 10:27951298-27951320 CATTTTTAAAACTTATTTTTTGG - Intronic
1065788486 10:29238215-29238237 CATGACTATATTTTATTTTTAGG - Intergenic
1066185602 10:33007507-33007529 CATGACTAAAAGTTACTTTACGG - Intergenic
1066272002 10:33833190-33833212 CATGATTAGATTATATTATTTGG - Intergenic
1068185442 10:53579805-53579827 CATGATTAGACTGTAGTTTTTGG + Intergenic
1069183908 10:65398314-65398336 TAAGATTAGAAGTGATTTTCTGG + Intergenic
1070685648 10:78478430-78478452 CATGATAAGAAGTATTATTTGGG + Intergenic
1072281706 10:93871496-93871518 TATGTTAAGATGTTATTTTTTGG - Intergenic
1072354960 10:94599954-94599976 CAAGAATATAAGTTAGTTTTGGG - Intronic
1073370311 10:102982411-102982433 CAGGAATAGAAGGTATTTTTAGG + Intronic
1074155025 10:110790600-110790622 CATTAGTAAAAGTAATTTTTTGG + Intronic
1074672323 10:115805799-115805821 CATGATTTAAGGTTATTATTGGG - Intronic
1075224085 10:120609939-120609961 CATGGTAAAAAGTTATCTTTGGG - Intergenic
1076409958 10:130241629-130241651 CATGTCTAGAAGTTTTATTTGGG + Intergenic
1076605474 10:131686736-131686758 AATCCTTAGAAGTTGTTTTTTGG + Intergenic
1078035237 11:7797165-7797187 CATTATTTGAAGCAATTTTTTGG - Intergenic
1078124380 11:8545720-8545742 CTTGTTTTGAAGTTATTTCTAGG - Intronic
1078544007 11:12233673-12233695 CATGATAAGAAAGTATTCTTAGG + Intronic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1079392967 11:20038278-20038300 CAAGATCAGAAGTTATTTTAAGG + Intronic
1079664622 11:23089088-23089110 AATGAAGAGAAGTTATATTTTGG + Intergenic
1079913566 11:26340157-26340179 CAACTTTAGGAGTTATTTTTAGG - Intronic
1080228216 11:29985006-29985028 CACGACCAGAAGTTATTTTGGGG + Intergenic
1080412715 11:32040951-32040973 GGTGATTAGAAATTATTTTGTGG - Intronic
1080759987 11:35239568-35239590 CGAGATTAGATGATATTTTTTGG - Intergenic
1082032068 11:47612111-47612133 CCTGAAAAGAAGCTATTTTTTGG + Intergenic
1083210717 11:61183731-61183753 GAAGATTAGAATATATTTTTAGG - Intergenic
1086348500 11:85921902-85921924 CAAGATTAGAAATTATGGTTTGG - Intergenic
1087061806 11:93986195-93986217 CATTAATAGACTTTATTTTTTGG + Intergenic
1087873056 11:103323140-103323162 CATGAAGAGAAGTTATTTTAAGG - Intronic
1087971923 11:104494665-104494687 CAAGATTAGAAATTATGGTTTGG + Intergenic
1088040036 11:105369623-105369645 TATAATTAGAAATTATATTTTGG - Intergenic
1088212500 11:107472397-107472419 CCTTAATAGAACTTATTTTTTGG - Intergenic
1091411908 12:246564-246586 CATGTTCAGAAGTTTTATTTGGG - Intronic
1092122154 12:6052078-6052100 CATGATTTGGAGCTATTTTGGGG + Intronic
1095095950 12:38149387-38149409 CATGATTTGAAGTTTTTTTGAGG - Intergenic
1095730615 12:45502740-45502762 CATGATAACAAGTCATATTTAGG + Intergenic
1096177008 12:49528587-49528609 CATGATTAGAAGGGACTCTTGGG + Intergenic
1096208151 12:49740894-49740916 AATTAATAGAAGTTAATTTTCGG - Intronic
1097745997 12:63303727-63303749 CCTGAGAAGAAGTTAATTTTGGG - Intergenic
1097807602 12:63983094-63983116 TATGGAAAGAAGTTATTTTTAGG + Intronic
1098823736 12:75267610-75267632 CATGATTAGAATTTATTCCTAGG + Intergenic
1098868839 12:75793355-75793377 CATGGATAAAATTTATTTTTAGG - Intergenic
1099553396 12:84076717-84076739 CATGATTATAAGTCATTTGTAGG + Intergenic
1100097489 12:91059519-91059541 CAGAATTAGAAGTCATATTTTGG - Intergenic
1100185890 12:92139324-92139346 CATAATTATGAGTTATTTTGGGG + Intronic
1100251540 12:92829981-92830003 CATGTTTAGAAAGGATTTTTAGG + Intronic
1101416432 12:104512687-104512709 CATGATGAAAAGTATTTTTTAGG + Intronic
1101647553 12:106645256-106645278 CATGAATAGAGGTTATTGTGCGG - Intronic
1104190401 12:126476840-126476862 GATGATTAGAAATTATTTAACGG + Intergenic
1104340481 12:127944219-127944241 CAGGATTAGAAATTATGGTTTGG - Intergenic
1104541518 12:129670321-129670343 CAAGATTAGAAATTATGGTTTGG + Intronic
1105584175 13:21728788-21728810 CATGATCAGATTTTAATTTTAGG - Intergenic
1108355316 13:49624661-49624683 CTGGCTTACAAGTTATTTTTTGG + Intergenic
1108552506 13:51560452-51560474 CATGATTTGATGTCAGTTTTAGG + Intergenic
1109173631 13:59127308-59127330 CATGATTAGATTTATTTTTTGGG - Intergenic
1109178981 13:59190452-59190474 CAACAGAAGAAGTTATTTTTTGG - Intergenic
1109261843 13:60154285-60154307 GAAGATTAAAAGTTATGTTTTGG - Intronic
1109833408 13:67823982-67824004 CATGAATATAAAATATTTTTAGG - Intergenic
1109893260 13:68647237-68647259 CATGTTTAGAAGTAGATTTTTGG + Intergenic
1109964746 13:69677447-69677469 AAAAATTTGAAGTTATTTTTTGG - Intergenic
1110641855 13:77834086-77834108 CATAGTGAGAAATTATTTTTTGG + Intergenic
1110793421 13:79610548-79610570 CATGATTTGAAGTTTCCTTTTGG + Intergenic
1111267684 13:85839541-85839563 CAGGATTAGACATTATATTTTGG + Intergenic
1111522294 13:89422255-89422277 CATTATTAAAGGATATTTTTGGG + Intergenic
1111708691 13:91783941-91783963 TATGATTATAAATTATCTTTTGG - Intronic
1111787634 13:92810557-92810579 AATGATTACAAGTTCTTGTTTGG - Intronic
1112808096 13:103185142-103185164 AATGATTAGAAATTATTATGGGG + Intergenic
1113392061 13:109907524-109907546 CTTGATTAGAAGGTACTTTCTGG - Intergenic
1114177108 14:20332195-20332217 CATTGTTAAAATTTATTTTTTGG - Intronic
1115348817 14:32371105-32371127 CAAGACAAGAATTTATTTTTAGG - Intronic
1115823476 14:37237426-37237448 CTTGATTTGATGTTTTTTTTTGG + Intronic
1116025791 14:39512710-39512732 AATGATTATAAATTCTTTTTTGG + Intergenic
1116083894 14:40209607-40209629 CATGTTTAGATGTAAATTTTTGG - Intergenic
1116925677 14:50634293-50634315 CATGTTGAGAAAGTATTTTTTGG - Exonic
1118245565 14:64106882-64106904 CATAACTAGAATTTATTGTTAGG + Intronic
1120109249 14:80534097-80534119 CATGATTAAGTGATATTTTTTGG + Intronic
1120933415 14:89871260-89871282 AATCATTAGAAGTTTGTTTTGGG - Intronic
1121347362 14:93145817-93145839 CATGATTAGAAATTAGATGTTGG + Intergenic
1121467088 14:94122857-94122879 CAAGATGAGATGTTATGTTTTGG + Intergenic
1121926261 14:97930059-97930081 AAGAATGAGAAGTTATTTTTAGG - Intronic
1121945043 14:98111981-98112003 CATGATCTGCATTTATTTTTAGG - Intergenic
1122051432 14:99063402-99063424 GAGGATTAGAAGTTAATATTTGG + Intergenic
1122666044 14:103330513-103330535 TATGATTAAGAGTAATTTTTAGG + Intergenic
1124019418 15:25905499-25905521 GATCATTAAAAGTAATTTTTAGG + Intergenic
1125618147 15:41034499-41034521 GATGATAGGAAGTTATATTTAGG + Intronic
1126188935 15:45859197-45859219 CATGATTTGAATTTATTACTGGG + Intergenic
1126521187 15:49595986-49596008 CAGGAATACCAGTTATTTTTAGG - Intronic
1126982779 15:54264449-54264471 TATTATTAGCAGTTATTTCTAGG - Intronic
1129571470 15:76689585-76689607 CAGGTTTAGAAGCCATTTTTAGG - Intronic
1129631013 15:77260574-77260596 TATCTCTAGAAGTTATTTTTTGG - Intronic
1132448138 15:101947965-101947987 CATTTTTACAAGTTATTTTATGG + Intergenic
1133923077 16:10172036-10172058 TATGAATAGCAGTTATCTTTGGG - Intronic
1134368107 16:13598010-13598032 CATGATTAAAAGTTTAGTTTTGG - Intergenic
1134441902 16:14303375-14303397 CATATTTATAATTTATTTTTAGG + Intergenic
1136177934 16:28531229-28531251 CATAATTAGAAATTAATTGTAGG - Intergenic
1137011439 16:35325170-35325192 TATGATTTGAAGGTAATTTTTGG - Intergenic
1137398133 16:48131510-48131532 CATGAACAGAGGTGATTTTTTGG - Intronic
1137915620 16:52426782-52426804 CATGATGAGAAGTTGTTAATGGG + Intergenic
1139137596 16:64223664-64223686 CATGCTTACAAGTTAATTCTAGG + Intergenic
1139138251 16:64231549-64231571 CATGATTAGGTTTTCTTTTTTGG - Intergenic
1139454584 16:67062935-67062957 CATGATTAGAATTTATAATGAGG + Intronic
1140159835 16:72477754-72477776 AATGATTAGAACTAATTTGTGGG + Intergenic
1143804203 17:9412936-9412958 CATGATTAGATGTTTGCTTTAGG + Intronic
1144553131 17:16259002-16259024 AATGACTAGAAATTGTTTTTTGG - Intronic
1144722465 17:17481009-17481031 CATGAGTAGATGCTATTTCTTGG - Intronic
1146043732 17:29484046-29484068 TTTGATTAGAAGGTATTTGTTGG + Intronic
1148728206 17:49811964-49811986 CATGATTAAAAGGTATTAATTGG + Intronic
1149106893 17:52979810-52979832 CATTCTTCTAAGTTATTTTTGGG + Intergenic
1149238812 17:54624503-54624525 AATGTTAATAAGTTATTTTTAGG - Intergenic
1149884977 17:60330787-60330809 TATGATATGAAGTTATATTTGGG - Intronic
1152841736 17:82573602-82573624 CATGGGTAGAAGTTATTATCTGG - Intronic
1153117481 18:1677227-1677249 AATGATTAGAAGTAGTTTTGGGG - Intergenic
1153264525 18:3256894-3256916 AAATAGTAGAAGTTATTTTTAGG - Intergenic
1153369385 18:4296953-4296975 CATCATCTGGAGTTATTTTTCGG + Intronic
1153435754 18:5066438-5066460 CTTGATTTGAACCTATTTTTTGG - Intergenic
1154174200 18:12073651-12073673 CAGGATTAGCAGTCATTTCTGGG - Intergenic
1155188886 18:23411998-23412020 CATGTTTGGAAACTATTTTTTGG - Intronic
1155261597 18:24048801-24048823 AAAGACTAGAAGTTATTTTTAGG + Intronic
1156071919 18:33221923-33221945 TATGATTTTAAGTTATCTTTTGG + Intronic
1156171209 18:34488525-34488547 CATAATTAAAACTTATTGTTGGG - Intergenic
1157532946 18:48437600-48437622 CATAAGTAAAAGGTATTTTTTGG + Intergenic
1159483618 18:69025133-69025155 CACGATTAGAATTTTTTTATAGG - Intronic
1159607155 18:70486961-70486983 CATGCTTAAAAGTTTTTTTATGG + Intergenic
1160412698 18:78685787-78685809 CATGACTAGACGTTATATTCTGG + Intergenic
1160637129 19:84587-84609 CATTTTTACAAGTTATTTTATGG - Intergenic
1162608127 19:11727556-11727578 CTTGGTTAGAAGGTTTTTTTGGG - Intronic
1164382393 19:27746009-27746031 GATGATCAGAGGTTAGTTTTAGG - Intergenic
1164991533 19:32688019-32688041 CATTCTGAGAAATTATTTTTAGG - Intergenic
1167389887 19:49188042-49188064 CAAGATTAGAAATTAAGTTTAGG - Intronic
926176159 2:10594040-10594062 CATGATCCATAGTTATTTTTTGG - Intronic
926584452 2:14670744-14670766 GAAGTTTACAAGTTATTTTTTGG + Intergenic
926883018 2:17569523-17569545 CATTATTAGAAGCTATTAATTGG + Intronic
927050420 2:19322499-19322521 CATGATCACAACTTATTTTTAGG - Intergenic
927428302 2:23005351-23005373 AATGATGAGAAGTTCTGTTTGGG + Intergenic
928619621 2:33075322-33075344 CATGATTTAAAAATATTTTTTGG + Intronic
929266828 2:39927997-39928019 CATCATTAAAAGTCATGTTTAGG - Intergenic
929837365 2:45417388-45417410 CATGGTTAGAATTTAGTTTGTGG - Intronic
931013647 2:57949218-57949240 AATGATTACAAGTTATATTCAGG + Intronic
932136402 2:69234079-69234101 CATTATTCTAAGTTATTGTTTGG + Intronic
932915312 2:75851963-75851985 CATGATTAGAATTTTGTTTGTGG + Intergenic
932926973 2:75987894-75987916 TATGAGTAGTAGTTATGTTTGGG - Intergenic
933187959 2:79299898-79299920 AATTAATAGAAGTTATTTTTAGG + Intronic
933240454 2:79915222-79915244 AATTATTAGCAGTTATTTTGGGG - Intronic
934042760 2:88142995-88143017 CATGTTTAGTAGTTTTTTATTGG + Intergenic
934082522 2:88481420-88481442 AATGATTAGAAGTAATACTTTGG - Intergenic
934576930 2:95408269-95408291 CCAAATTAGAAGTTATCTTTGGG - Intronic
935138005 2:100324246-100324268 CATATTTAAAAGTTCTTTTTTGG - Intergenic
936891055 2:117370771-117370793 CAAGATTAGAAATTATGGTTTGG - Intergenic
937069426 2:119051652-119051674 CATTTTCACAAGTTATTTTTTGG + Intergenic
937205521 2:120234291-120234313 TCTGCTTAGAAGTTCTTTTTAGG - Intergenic
937631975 2:124111784-124111806 CAGGAATAAAAGTTATTATTTGG - Intronic
937762369 2:125621348-125621370 CATGTTTGGAAATTATTTTATGG - Intergenic
939003564 2:136762046-136762068 CAGGATTAAATGTTCTTTTTTGG + Intergenic
939374227 2:141343227-141343249 CATCACTAGAAGTTCTATTTAGG + Intronic
939586870 2:144016591-144016613 CATGATTAGAGACCATTTTTAGG - Intronic
939920608 2:148107147-148107169 GATTCTTAGAAGTTATTTTGAGG + Intronic
940074722 2:149728460-149728482 CAGGATTAGACTTTATCTTTAGG + Intergenic
941026084 2:160457918-160457940 CATTTTTAAAATTTATTTTTGGG + Intronic
941227002 2:162863096-162863118 CATCATTAGTAAGTATTTTTTGG - Intergenic
942064551 2:172258185-172258207 CATGCATTGCAGTTATTTTTAGG + Intergenic
942198401 2:173545918-173545940 TATTTTTAAAAGTTATTTTTTGG + Intergenic
942237293 2:173923494-173923516 AATAATTAGCAGTTAATTTTAGG - Intronic
942867104 2:180690136-180690158 AATGATAAGAAGTTCTATTTTGG + Intergenic
942905464 2:181174946-181174968 TATGACTAGCAGTTATTTTCTGG + Intergenic
944252751 2:197593918-197593940 CATGATGAGAAGTTTGCTTTGGG + Intronic
945129042 2:206546589-206546611 CATGACAAGAAGTTATCTTTGGG - Intronic
945240449 2:207671766-207671788 CATGTTGAGAAGGTATTTTTTGG + Intergenic
946861847 2:224007596-224007618 CATGTTAAGGAGTTATTTTGCGG - Intronic
946922290 2:224592442-224592464 CAATATTAGAAGTTGTTTTATGG + Intergenic
946997946 2:225417332-225417354 CATGATTAAAATTAATTTTAAGG - Intronic
947519986 2:230838170-230838192 CAAGATTAGAAATTATGGTTTGG + Intergenic
948958272 2:241312388-241312410 CTTGGTTACATGTTATTTTTTGG - Intronic
1169722765 20:8697148-8697170 CCTGATGAGAATTTATTGTTGGG - Intronic
1169874114 20:10278093-10278115 CAAGATTAGATGTAATTTATAGG - Intronic
1177029238 21:15961949-15961971 TAGGATTATAAGTGATTTTTAGG - Intergenic
1177162978 21:17568795-17568817 CATGAATAGTAGACATTTTTGGG - Exonic
1177606770 21:23390077-23390099 CTTGTTTGGAAGTTATTTCTGGG - Intergenic
1178039062 21:28619326-28619348 CCTTATGAGAAGTTATTTTCTGG + Intergenic
1178069457 21:28947239-28947261 AATGGTTAGAAGGTATTTCTGGG + Intronic
1178787705 21:35668758-35668780 CACATTTAGAAGTTAGTTTTGGG - Intronic
1181874907 22:25932708-25932730 CTGGATTAGAAAATATTTTTAGG - Intronic
1184929597 22:47671328-47671350 CATGCTTTGAATTTTTTTTTTGG - Intergenic
949174096 3:1037447-1037469 CATGATTACAAGGTAGGTTTTGG + Intergenic
950687269 3:14627544-14627566 GATGAATAGAAGTGTTTTTTTGG - Intergenic
952225330 3:31369628-31369650 AATGATGAGAAGTTAATGTTGGG - Intergenic
953618908 3:44515626-44515648 GATGATTAGTAGTTAAATTTGGG + Intergenic
954230009 3:49209665-49209687 CATGAGTATAAGGTATTTTGAGG + Intronic
954341870 3:49960654-49960676 CAAGATAAGAAGTTATTTCCAGG - Intronic
955470091 3:59277804-59277826 CCTGATAAGAATTTATTGTTTGG - Intergenic
955543418 3:60001944-60001966 CATGATAAGAAAATATTTTGTGG + Intronic
956211425 3:66805382-66805404 TATGATTAAATGTTATTTTGGGG - Intergenic
956547553 3:70421495-70421517 CCTGATTAGATTTTATTTGTAGG - Intergenic
956997624 3:74845980-74846002 CGTGATTGGAAGTGAATTTTGGG + Intergenic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
957613821 3:82503733-82503755 CATGTTTTGAAATTAATTTTGGG - Intergenic
957716148 3:83931501-83931523 CACCATTGGAAGTTATTTTGGGG - Intergenic
957909265 3:86601312-86601334 CATGATGAGACCTCATTTTTGGG - Intergenic
957911376 3:86623616-86623638 CACCATTAGAAGATAATTTTTGG - Intergenic
959372258 3:105542220-105542242 GATCATTAGAAGTTATTTATTGG + Intronic
960185772 3:114636608-114636630 GATGATTATAAGTTGTTTTATGG + Intronic
960285873 3:115827943-115827965 CATCATCACAAGTTATTTGTAGG - Intronic
960823596 3:121759560-121759582 ACTGCTTAGAAGTTATTTTAAGG - Intergenic
961266310 3:125645769-125645791 CATGAGATGAAGTTATTTTGAGG + Intergenic
961938871 3:130616285-130616307 CAGGATTTGAAGTTTTTCTTAGG + Intronic
962505429 3:136041878-136041900 CTTCTTTAGGAGTTATTTTTTGG + Intronic
962626871 3:137234383-137234405 CCTGATTAGAAGGTAGTTTCAGG + Intergenic
962767416 3:138578528-138578550 CATGATGAGAAGAAACTTTTGGG + Intronic
963845305 3:150149629-150149651 AATGATTTGAAGTCCTTTTTTGG - Intergenic
963914945 3:150850487-150850509 CATGATTGTAAGTTTTTTTGAGG + Intergenic
964041061 3:152262362-152262384 CATGATTTGAAGGTAATTTCAGG + Intronic
964330030 3:155592120-155592142 AATGATGAGAAGTTGTCTTTTGG + Intronic
964867534 3:161277639-161277661 AATGATCAAAAGTTAATTTTAGG - Intergenic
964955010 3:162343805-162343827 CATGATTTAAAGTTGTTTCTTGG + Intergenic
966999244 3:185316338-185316360 CATCATCAAAAGTTCTTTTTTGG + Intronic
967210072 3:187160428-187160450 CAAGATTAGAAATTATGGTTTGG - Intronic
968419376 4:470452-470474 CCTGATAACAAGTTAATTTTGGG + Intronic
970895814 4:21102797-21102819 CATCATTAAAAGTAATTTGTGGG - Intronic
971033901 4:22671733-22671755 AATGATTAAAGTTTATTTTTGGG - Intergenic
971637482 4:29080313-29080335 AATGATTAGAGGTCATTTTGGGG + Intergenic
971841689 4:31861243-31861265 CATTTTTAAAAGTTATTTTTGGG + Intergenic
972840645 4:42926318-42926340 TATGAGCAGAAATTATTTTTTGG + Intronic
972929029 4:44048498-44048520 AATTATTAGCAGTTCTTTTTTGG - Intergenic
973306316 4:48655252-48655274 CCTGATTTGAATTTACTTTTTGG - Intronic
974832218 4:67203546-67203568 CATGCTGTGAAGTTATTTTGGGG - Intergenic
975492436 4:75003429-75003451 TATGATTAGAACTGATTTTATGG + Intronic
975879416 4:78885543-78885565 CAAAATTAAAAGTCATTTTTAGG + Intronic
975935888 4:79579514-79579536 AATGATTACATGTTACTTTTTGG + Intergenic
977066636 4:92325063-92325085 TATGATTATATGTTATATTTAGG + Intronic
977408270 4:96629042-96629064 TATGATGAAAAGTTATTATTTGG + Intergenic
977576462 4:98679775-98679797 CGTTATTAGAAATTATTTTCTGG - Intergenic
977918130 4:102615638-102615660 CTTAATTTGTAGTTATTTTTAGG + Intronic
978387898 4:108194105-108194127 CTTGATCAGATGTTATTTTCAGG + Intergenic
978469323 4:109045794-109045816 CATGATTATACTTTATTTCTTGG + Intronic
978602906 4:110447523-110447545 CATCATTGGAATTTATTCTTGGG - Intronic
979180128 4:117715130-117715152 CATGATTTAATTTTATTTTTTGG - Intergenic
979958502 4:126987011-126987033 CATGAGTAGCAGGTTTTTTTAGG + Intergenic
980447506 4:132930123-132930145 CATTAGTAGAAATTATTTTAGGG - Intergenic
980567739 4:134566917-134566939 TTTGAATAGAAGTAATTTTTAGG + Intergenic
981741702 4:148009066-148009088 CATGATCAGAAGTTCTTTGGGGG + Intronic
982020077 4:151194342-151194364 TATGATTAGGAGTTATTTGTTGG + Intronic
982150792 4:152454415-152454437 CATTATCAAAAGTTATTTGTAGG - Intronic
982475071 4:155840737-155840759 CAAGATTAGAAATTATGTTTAGG + Intronic
982885717 4:160779490-160779512 GTTGATTAATAGTTATTTTTGGG + Intergenic
983616614 4:169712839-169712861 CATGGAAAGAAATTATTTTTTGG - Intronic
983663402 4:170155087-170155109 AATGATTCTAAGTGATTTTTAGG + Intergenic
983714588 4:170764533-170764555 AATGATTAAAACTTATTTTTAGG + Intergenic
984264634 4:177482897-177482919 CATGATTATATTTTATTTTGAGG + Intergenic
984428931 4:179624018-179624040 CAAGATAAGAAATTATTTTTGGG + Intergenic
985689876 5:1301448-1301470 CATTATTAGCAGTTGTTTTAGGG + Intergenic
987158907 5:15119629-15119651 CATTATTAGGAGTTATATTTTGG + Intergenic
987253972 5:16129341-16129363 CATGATTAGCAGTGTTTGTTTGG + Intronic
987662693 5:20897301-20897323 CTTGGTTACAATTTATTTTTAGG + Intergenic
987688341 5:21233790-21233812 CATGAATAGACTTTATTTGTTGG - Intergenic
987707507 5:21474624-21474646 CATGTTTAAGAGTTATTGTTAGG - Intergenic
987810538 5:22829102-22829124 TATTATTAGAAGTTATTCTATGG - Intronic
988206327 5:28140783-28140805 CATGAGTAGCAGTTCATTTTGGG - Intergenic
989150827 5:38298298-38298320 CATCATTAGAGATAATTTTTAGG + Intronic
989992115 5:50779362-50779384 CATGATTTGCAGTTATGTGTGGG + Intronic
990246183 5:53865418-53865440 GATGTTTAGAAGTTACATTTGGG - Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990795354 5:59533837-59533859 CAAGATTATAAGATATTTTAAGG - Intronic
990935067 5:61139304-61139326 CATGATGAGAAGGTATTGTATGG + Intronic
991274031 5:64822107-64822129 CATGATTAGGGTTTGTTTTTGGG + Intronic
991274907 5:64834465-64834487 CATGTTTATAATTTAGTTTTTGG + Intronic
993381125 5:87209435-87209457 CATTATTAGAAGTTGTTAGTTGG + Intergenic
993512083 5:88783090-88783112 CATGATTGGTAGTCCTTTTTAGG - Intronic
994872803 5:105375236-105375258 CTTGGTTAGATGTTATTTCTAGG + Intergenic
995281294 5:110338643-110338665 CAAGATTAGAAATTACTGTTTGG - Intronic
995453938 5:112332329-112332351 CATTATTTGAAGTAATTATTTGG + Intronic
995845556 5:116490239-116490261 TATGATTCGTAGATATTTTTTGG - Intronic
996264488 5:121520822-121520844 CATTACTAGAATTTATTATTGGG - Intergenic
997170740 5:131717510-131717532 GATAATTAGAAAATATTTTTAGG - Intronic
998524541 5:142830362-142830384 AATGATTAAAAATTATTTTGTGG + Intronic
998743106 5:145227610-145227632 CATGATGAGAATCCATTTTTTGG + Intergenic
998796000 5:145819631-145819653 CATGATTAGAAATTACTCTTAGG - Intronic
998880940 5:146644118-146644140 CATGAATACAAGTTATTTTTTGG - Intronic
1000598792 5:163247537-163247559 GTTTATTAGAAATTATTTTTCGG - Intergenic
1000841623 5:166226486-166226508 CATGATTCTTAGTTATTTCTAGG - Intergenic
1000971735 5:167722240-167722262 CATGATTAGCCGTTAATATTTGG + Intronic
1004246305 6:13979647-13979669 CATGTTTAGAAGATGTTTTGTGG + Exonic
1004369871 6:15043118-15043140 CATAATTAGAGGTTATCTCTGGG + Intergenic
1004813924 6:19291796-19291818 CATGAATAGTAGTTATTAGTGGG - Intergenic
1005416151 6:25602418-25602440 CATGATTAACAGTTTCTTTTTGG + Intronic
1006292081 6:33146074-33146096 TATGATGACAAGTTAGTTTTGGG + Intergenic
1008411361 6:51183722-51183744 CATGATTAGGATTTTTTGTTAGG - Intergenic
1008853950 6:56058629-56058651 TATGATTAGATGTTATTAATAGG - Intronic
1010056082 6:71566611-71566633 CATAAATAGAAGTTATTTTTTGG - Intergenic
1010771198 6:79832989-79833011 CATGAATATTAGTTATATTTCGG - Intergenic
1010952505 6:82054134-82054156 CATGATTCAAAATCATTTTTAGG - Intergenic
1011745952 6:90407800-90407822 AATGATCAAAAGTTAGTTTTAGG + Intergenic
1012336502 6:98065788-98065810 CATGATTAAAATATATTTATTGG - Intergenic
1012365954 6:98440791-98440813 TTTAATTAGAATTTATTTTTAGG - Intergenic
1012538558 6:100330225-100330247 CCTGATTAGAACTTAATTTAAGG + Intergenic
1013640197 6:112068012-112068034 CTTGATTGAAAGTTAATTTTGGG + Intronic
1014723017 6:124941110-124941132 CTTGATTTGAAGTTATTCCTGGG - Intergenic
1016347255 6:143127372-143127394 CATGTTTTCAAGTTAATTTTAGG - Intronic
1016717983 6:147255906-147255928 CATGATAAGCAGGTATTTTTTGG + Intronic
1016774405 6:147889306-147889328 AATCATTAGAAGTTTTATTTGGG + Intergenic
1017577914 6:155826131-155826153 CATGCATAGGAGTTTTTTTTTGG - Intergenic
1018977481 6:168576313-168576335 CATGATTACAAGAGCTTTTTGGG - Intronic
1019646345 7:2131355-2131377 CATGAATAGAACTGATTTTATGG - Intronic
1020808210 7:12817473-12817495 CATGATTGGAAATTATTGGTTGG + Intergenic
1021020446 7:15591798-15591820 CATGATTTGAAAGTATTTTCTGG - Intergenic
1021071278 7:16244324-16244346 CATAATTGGATTTTATTTTTAGG - Intronic
1021243822 7:18237238-18237260 CATGATTAGAAGTTATTTTTAGG + Intronic
1021411560 7:20334837-20334859 CAAGAGAAGAAGTTATTTTGGGG - Intronic
1021789586 7:24191031-24191053 CATCACTAGAAATTCTTTTTGGG + Intergenic
1022127558 7:27372893-27372915 CATCATTAGCAGTTATGGTTGGG + Intergenic
1024536816 7:50441846-50441868 CATGCTTATATGTTATTTATTGG - Intergenic
1025175335 7:56797884-56797906 CATAATGTTAAGTTATTTTTTGG + Intergenic
1025604964 7:63033003-63033025 CATCTCTAGAAGTTATATTTGGG - Intergenic
1025696465 7:63778527-63778549 CATAATGTTAAGTTATTTTTTGG - Intergenic
1026228908 7:68466477-68466499 CAGGATTAGAAATTATGGTTAGG + Intergenic
1026494604 7:70891671-70891693 CAAGATTAGAAATTATGGTTTGG + Intergenic
1027477489 7:78651557-78651579 TATTATTGGAAGTTATTTTCTGG - Intronic
1027925639 7:84459453-84459475 AAAGATTACAAGTTATTGTTTGG - Intronic
1028529797 7:91825766-91825788 CCTCATTAGAACTTAATTTTAGG + Intronic
1028563841 7:92205833-92205855 CAGGTTTATCAGTTATTTTTTGG - Intronic
1029369733 7:100141324-100141346 CATGATTAGAAGTGAGCTATGGG - Intergenic
1030545344 7:110887708-110887730 CACAATAAGAAGTTATTTTGGGG + Intronic
1031009786 7:116513933-116513955 TATGATAACAAATTATTTTTTGG - Intergenic
1031111541 7:117616464-117616486 CATGGTGAAAAGATATTTTTAGG - Intronic
1032070501 7:128803044-128803066 AAACATTAGAAGTTACTTTTAGG + Intronic
1032714295 7:134491647-134491669 GATGACTAGAAGTGATGTTTTGG - Intergenic
1032899339 7:136289280-136289302 CTGGAGTAGAAGTTATTTTACGG + Intergenic
1033626104 7:143111016-143111038 CATGCTTAGAATTTTATTTTTGG + Intergenic
1033982460 7:147182403-147182425 CATGACTATATCTTATTTTTAGG - Intronic
1035218072 7:157385425-157385447 CATGAATATAAGTAATTTTCAGG - Intronic
1036780056 8:11640420-11640442 CATCTCTAGAAGTTATATTTGGG + Intergenic
1037112150 8:15176498-15176520 TATGTTTAAAAGTTAATTTTTGG - Intronic
1037790661 8:21937648-21937670 AATCATCAGAAGTTATTTATTGG + Intronic
1037844279 8:22269234-22269256 CATTTTTAGAAGTTCTGTTTTGG + Intergenic
1039193343 8:35002014-35002036 CATGACTAGAAATTATTCTCTGG - Intergenic
1041122031 8:54595717-54595739 AATAATTAGAAATTATTTTGTGG + Intergenic
1041758042 8:61335219-61335241 CAAGATTAGAAATTATGGTTTGG - Intronic
1043109186 8:76156921-76156943 CCTCATTAGAAGATATTTTATGG - Intergenic
1043185374 8:77141499-77141521 TGTGATTAGAAGTTGTTTTAAGG - Intergenic
1043625362 8:82250556-82250578 CATAATTAGAAGCTCTTTTTTGG + Intergenic
1043706072 8:83352429-83352451 CAAGATTAGAAATTATGGTTTGG - Intergenic
1044491153 8:92816605-92816627 AATGATTAAAAGTTACTTTCTGG - Intergenic
1044545760 8:93457336-93457358 GATGGTTAGAAGTTTTTCTTAGG + Intergenic
1044710785 8:95055346-95055368 AATGACTAGCAGTTATCTTTTGG - Intronic
1045984230 8:108229843-108229865 CATGATTAGAAGTGTAATTTGGG - Intronic
1046417030 8:113930655-113930677 CATAATTTAAAGTTATTTTTTGG - Intergenic
1046664738 8:116988257-116988279 AATAATTAGAAGATATTTTAGGG + Intronic
1047042152 8:121007962-121007984 CAAGTTTAGAAATTATGTTTAGG - Intergenic
1047260209 8:123251020-123251042 CCTGATTAAAAGTTATGTATGGG - Intronic
1047593997 8:126357954-126357976 CATAATTAGAATTTAATTATGGG + Intergenic
1048952103 8:139504886-139504908 CAAGATTAGAAGTCATTTTCTGG - Intergenic
1050931731 9:11337107-11337129 CATGAGTCTGAGTTATTTTTTGG + Intergenic
1051371877 9:16365707-16365729 CAAGATTAGAAATTATGGTTTGG - Intergenic
1051604126 9:18904166-18904188 CACAATAAAAAGTTATTTTTTGG + Intronic
1052661340 9:31436181-31436203 CCTGCTTAGAAGATATTTTCTGG - Intergenic
1053531375 9:38884885-38884907 TATAATTAGAATTTATTGTTGGG + Intergenic
1054203599 9:62109314-62109336 TATAATTAGAATTTATTGTTGGG + Intergenic
1054634763 9:67479050-67479072 TATAATTAGAATTTATTGTTGGG - Intergenic
1054840226 9:69730552-69730574 CATGATTACAAGTTGTTTGGTGG - Intronic
1055346756 9:75347649-75347671 CATGGTTTGAAGTTTTCTTTTGG + Intergenic
1055569915 9:77606239-77606261 CCTTCTTAGAATTTATTTTTTGG - Intronic
1056038486 9:82635224-82635246 TATTAATAGACGTTATTTTTAGG + Intergenic
1058144254 9:101394212-101394234 CAAGATTAGAAATTATGGTTAGG + Intronic
1060626085 9:125113299-125113321 CATGATTAGATTGGATTTTTAGG - Intronic
1060890516 9:127185059-127185081 CACGATGAGAAGTTCATTTTGGG - Intronic
1061946749 9:133912859-133912881 GATGAATAGAAGCTATGTTTGGG - Intronic
1062677614 9:137756681-137756703 CAAGACTAAAAGTTGTTTTTGGG + Intronic
1185955988 X:4489576-4489598 CATAATTAGAAGTTTTTCTTTGG - Intergenic
1187606591 X:20891339-20891361 AATGATTTGAAAGTATTTTTTGG - Intergenic
1187652370 X:21422550-21422572 CATGATAACCAGTTATTATTTGG + Intronic
1189130381 X:38492014-38492036 CATGATTAGAATTTTATTTTTGG - Intronic
1189460929 X:41242459-41242481 CTTCATCAGAAGTTAATTTTAGG + Intergenic
1191127604 X:56974438-56974460 CAAGATTAGAAATTATGGTTTGG + Intergenic
1194823782 X:98536651-98536673 CATGTTTTGAAGTTTTTTTCTGG - Intergenic
1198175423 X:134149758-134149780 CCTGATTAGAAGTTCCATTTTGG - Intergenic
1198213053 X:134532974-134532996 CAAGATTAGAAATTACATTTGGG + Intergenic
1198675034 X:139122277-139122299 CATGGTGTGAAGTTATTTTGAGG + Intronic
1199249897 X:145648715-145648737 AATGATTGGAAGTTAATTTTGGG + Intergenic
1200281263 X:154778903-154778925 CTTGATTAGCAGTTACATTTTGG + Exonic
1201434884 Y:13946489-13946511 TGTGAATAAAAGTTATTTTTAGG - Intergenic
1201855206 Y:18534074-18534096 CAGGATTAGAAGTTAGGTTTGGG + Intergenic
1201878115 Y:18786310-18786332 CAGGATTAGAAGTTAGGTTTGGG - Intronic
1202172714 Y:22067618-22067640 CAAGATTAGATGTTAGTTTTAGG - Intergenic
1202218648 Y:22518753-22518775 CAAGATTAGATGTTAGTTTTAGG + Intergenic
1202324538 Y:23677302-23677324 CAAGATTAGATGTTAGTTTTAGG - Intergenic
1202546233 Y:25992752-25992774 CAAGATTAGATGTTAGTTTTAGG + Intergenic