ID: 1021254945

View in Genome Browser
Species Human (GRCh38)
Location 7:18380542-18380564
Sequence GGATGCAGCAATTGACTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021254945 Original CRISPR GGATGCAGCAATTGACTGTA TGG Intronic
901216352 1:7557663-7557685 ATATGCAGCAATTGACTGACGGG - Intronic
902498518 1:16892021-16892043 GGAGTCCGCAGTTGACTGTAGGG + Intronic
902639387 1:17756851-17756873 TGATGCTGCACTTGACTGTGTGG + Intronic
904843661 1:33391486-33391508 GGAGACAGCAAATCACTGTACGG + Intronic
906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG + Intronic
908819649 1:68071193-68071215 GCATGCAGCTGTTTACTGTAAGG + Intergenic
909760199 1:79276908-79276930 GGTTCCTTCAATTGACTGTAAGG - Intergenic
911132554 1:94404634-94404656 GGATGCAGAAATAGAATGGAAGG - Intergenic
911957585 1:104257904-104257926 TGATAGAGCAATTGTCTGTAAGG + Intergenic
923330905 1:232923789-232923811 TGAAGTAGCAATTGACTGAATGG - Intergenic
924690412 1:246344271-246344293 GGATGGAGGACTTGAATGTAAGG - Intronic
1067964150 10:50889847-50889869 GAATGCAGCCATTGGCTGGATGG + Intergenic
1069082449 10:64102752-64102774 GGATGCAGCAATTGAAGCAATGG - Intergenic
1080880032 11:36311126-36311148 GAATGCAGCAATTGAGTTTAGGG + Intronic
1083068277 11:59948288-59948310 GGAAGTACCAAATGACTGTAAGG + Intergenic
1088502779 11:110499216-110499238 AGACGCAGGAATTGAGTGTATGG + Intergenic
1091613079 12:2028124-2028146 GGATGCAGTATTTGAATTTAAGG + Intronic
1098019598 12:66139568-66139590 GGAGACCGCAAGTGACTGTATGG - Intronic
1101213581 12:102559305-102559327 GGATGTAGCAATTGATTAAATGG - Intergenic
1102246117 12:111357120-111357142 TGATGCAGCAATTCACTGCTTGG - Intergenic
1103046356 12:117738104-117738126 GGACTCAGCAATTGAGAGTAAGG + Intronic
1104751323 12:131241345-131241367 CGATGCAGCAATTCACTATCTGG + Intergenic
1106065580 13:26345165-26345187 TCATGCAGCATGTGACTGTACGG + Intronic
1107727784 13:43317300-43317322 GGGTGCAGCAGCTGACTGAAGGG - Intronic
1108854560 13:54776095-54776117 TGATGCAGCAGTGGACTGTCTGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109313649 13:60724613-60724635 AGATGCATCAATATACTGTATGG + Intergenic
1111520720 13:89399934-89399956 AAATTCAGCAATTGACTTTAGGG + Intergenic
1111835960 13:93388612-93388634 GGAGGCATCATTTGAGTGTAAGG - Intronic
1112395761 13:99029318-99029340 GGAAGCAGCCATCAACTGTAGGG - Intronic
1112879544 13:104088748-104088770 GTATGAAGCAATTGACGGGAAGG - Intergenic
1116089693 14:40289394-40289416 GGATGCATCAAGTGACTCTTCGG - Intergenic
1120075885 14:80157881-80157903 TGATGGAGCAATTTACTTTAAGG - Intergenic
1125007103 15:34829614-34829636 GGGTGTAGAAATTGACTGGAAGG - Intergenic
1127783453 15:62335738-62335760 GGAAGCAGCTACTGCCTGTAGGG - Intergenic
1132173028 15:99683166-99683188 GGATGCAGGAAATTACTCTATGG + Intronic
1132297678 15:100753556-100753578 GGATGCAGCAATGAACTTTATGG + Intergenic
1133619121 16:7509272-7509294 TGCTGCTGCACTTGACTGTAAGG + Intronic
1133711743 16:8408246-8408268 GGATGCAGTAACAGACTCTAAGG + Intergenic
1134886118 16:17793267-17793289 AGAGGCAGCAATTGAATGTCAGG + Intergenic
1135623965 16:23979617-23979639 GGATTTAGCAACTGACTGAATGG + Intronic
1143713287 17:8748851-8748873 GGATGCAGCAAGGGACAGGAAGG + Intergenic
1151244793 17:72786130-72786152 GGTTTTAGCAATTGACTGCATGG + Intronic
1155596732 18:27496549-27496571 GGTTGGAGCAATTGGCTATAAGG + Intergenic
1159984539 18:74826626-74826648 GGATGCAGGAATTCTCTGTTTGG - Intronic
1160330254 18:77984635-77984657 GGATTCAGTAAATGACTGTGTGG + Intergenic
926729722 2:16027083-16027105 AGAGGAAGCAATTGACTTTAAGG - Intergenic
926989486 2:18662271-18662293 GGATGGAGCAGTAGACTGCAGGG + Intergenic
927142340 2:20139047-20139069 CAATGCAGCCATTGACTGTGTGG + Intergenic
927970958 2:27306269-27306291 GCATGGAGCAATTCACCGTAAGG + Exonic
928002623 2:27538083-27538105 GGATGGAGCATAGGACTGTAGGG + Intronic
928340204 2:30436223-30436245 TAATGCAGAAATTGACTGTAGGG - Intergenic
930181067 2:48358046-48358068 AGGTGTAGCAATTGAGTGTAAGG - Intronic
933223396 2:79716798-79716820 GGAGGTACCAATTGACTGCAGGG + Intronic
933245450 2:79970053-79970075 GTATGCACCTATTTACTGTAAGG - Intronic
933255041 2:80071332-80071354 GGATGCTACAATTGACGGCACGG - Intronic
936398056 2:112144214-112144236 GGATGCATCAATTGAATCTTCGG - Intronic
940525077 2:154802874-154802896 GGATGGAGGAATTGCCTGTATGG + Intronic
944822180 2:203441822-203441844 GGATGCAGTCATGGACTGAAAGG - Exonic
945493050 2:210478104-210478126 TGATCCAGCAATTGACTGCTGGG - Intronic
1170009115 20:11701664-11701686 GGATGCAGAATTTGAAAGTATGG - Intergenic
1171458525 20:25285403-25285425 CGATGCAGCAACTGACTGTGGGG - Intronic
1173534900 20:43801927-43801949 GGAAGCAGAGATTGACTGGAAGG - Intergenic
950643190 3:14361407-14361429 AGAGGAAGAAATTGACTGTATGG - Intergenic
953786439 3:45915130-45915152 GGAGGCAGCACTTTAATGTAAGG - Intronic
958587431 3:96107743-96107765 TCATGCAGCACTTGACTGTATGG + Intergenic
960845243 3:121998773-121998795 GGATGCAGCATTGGACTGTGGGG - Intronic
962308016 3:134305999-134306021 GGATGCAGAAAATGATAGTAGGG - Intergenic
964683210 3:159365356-159365378 GGAAGTAGAAATTGACTGTCAGG + Intronic
966076529 3:175941588-175941610 GGCTGCAGCAGTTGGCAGTAGGG - Intergenic
967800951 3:193658943-193658965 GGATGCAGCTATTTATTTTATGG + Exonic
974484858 4:62492345-62492367 GGATGCAGCAGTGGGCTGAAGGG + Intergenic
978690483 4:111503736-111503758 GGAGGTAGCAATTAACTGTGTGG + Intergenic
982943286 4:161585759-161585781 GGATGCAGCATTTACCTATAGGG + Intronic
991664148 5:68980740-68980762 TGATGCAGCAATTCACTGCTGGG + Intergenic
992668217 5:79032588-79032610 GGGTGGAGCAATGGAGTGTAAGG + Intronic
993938462 5:94030946-94030968 GCATGCAGCCATTGTCTGTTTGG - Intronic
994523359 5:100871304-100871326 GGATGGAGGAATTGACTGGCTGG - Intronic
1001674625 5:173501643-173501665 GGATGCAGCAATTCAAAGTCTGG + Intergenic
1019448808 7:1085446-1085468 GGTTGCAGAAACTGACTGCAGGG - Intronic
1021254945 7:18380542-18380564 GGATGCAGCAATTGACTGTATGG + Intronic
1021606480 7:22414177-22414199 GGGTGCAGCTATTGACTATGTGG - Intergenic
1022123717 7:27335463-27335485 GGAAGCAGTTGTTGACTGTAAGG - Intergenic
1022230977 7:28411374-28411396 GCACGCAGCAATTTATTGTATGG - Intronic
1023451967 7:40295857-40295879 GGATGCAGCAATTAAGCATATGG - Intronic
1026739317 7:72969023-72969045 GGATGCAGCATGTGATTGCAGGG - Intronic
1026790342 7:73327638-73327660 GGATGCAGCATGTGATTGCAGGG - Intronic
1027104414 7:75396050-75396072 GGATGCAGCATGTGATTGCAGGG + Intronic
1028160580 7:87480210-87480232 GGATGCAGAAGTTCACTGGAGGG - Intronic
1029058735 7:97774683-97774705 CGATTAAGCACTTGACTGTATGG - Intergenic
1029233371 7:99090461-99090483 GGATAGGGAAATTGACTGTAAGG - Intronic
1029303436 7:99601821-99601843 GGCTGCAGCAAGTGTCTGCATGG + Intronic
1033029030 7:137806954-137806976 GGATGAAGCAATTACCTGGATGG - Intronic
1033600178 7:142883722-142883744 GGATGCTGAAATTGCCTGCAAGG - Intronic
1034550620 7:151818405-151818427 GCATGCAGCATTTGACTTTTAGG - Intronic
1035641064 8:1185462-1185484 GGATGCTGAAATTGACTAAAAGG + Intergenic
1042782662 8:72509168-72509190 AGATGAAGCAGTTGACTTTAAGG - Intergenic
1042885291 8:73542906-73542928 TGATCCAGCAATTCACTCTAAGG + Intronic
1048592209 8:135831281-135831303 GGATGCATCAATTTTCAGTAAGG - Intergenic
1050658821 9:7860217-7860239 GCATGCAGCCATTGAGTGAAAGG - Intronic
1050890114 9:10814361-10814383 TGATTCAGCGATTGACTGTTTGG - Intergenic
1052538899 9:29780839-29780861 GGATGCAGCAGATGTTTGTATGG - Intergenic
1055648199 9:78380584-78380606 GGAGGCAGCCATTGATTCTATGG - Intergenic
1056840071 9:89991640-89991662 GGATGCAGCACTTGACTCAGAGG - Intergenic
1059568255 9:115406097-115406119 GGATGCAGCAGTTGACAAGACGG - Intergenic
1062193028 9:135257345-135257367 TGCTGCAGCACTTGACTGTCAGG - Intergenic
1193228818 X:79018276-79018298 GAATGATGCAATGGACTGTAGGG + Intergenic
1198002986 X:132459025-132459047 GAATGCAGTCATTGACTCTAGGG - Intronic