ID: 1021256097

View in Genome Browser
Species Human (GRCh38)
Location 7:18394201-18394223
Sequence GAGTGTCCCTTTAACAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021256097_1021256102 20 Left 1021256097 7:18394201-18394223 CCTTGTTTGTTAAAGGGACACTC 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1021256102 7:18394244-18394266 TCTTATTACTAAAATTCTGTAGG 0: 1
1: 0
2: 2
3: 34
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021256097 Original CRISPR GAGTGTCCCTTTAACAAACA AGG (reversed) Intronic
908078391 1:60546131-60546153 AATTTTCCATTTAACAAACAAGG - Intergenic
910425600 1:87117390-87117412 GAGTGTCCCTATACAAGACATGG - Intronic
911370410 1:96988782-96988804 AAGTGTGTCTTTAACAAATAAGG - Intergenic
913181940 1:116330691-116330713 TAGTGTCCCATTAAAAAAGAAGG + Intergenic
913692505 1:121292717-121292739 GAGTGCACCTTTAAAAAATAAGG - Intronic
914145051 1:144987377-144987399 GAGTGCACCTTTAAAAAATAAGG + Intronic
918973709 1:191453035-191453057 AAGTTTTTCTTTAACAAACACGG + Intergenic
919722884 1:200858848-200858870 GATTGTTCTTTTAACAAAAAAGG + Exonic
920479824 1:206311074-206311096 GAGTGCACCTTTAAAAAATAAGG - Intronic
921450560 1:215301075-215301097 GAGTATGTCTTGAACAAACATGG - Intergenic
921693328 1:218178164-218178186 GATAGTCCCTTGAACAAACTAGG + Intergenic
923790414 1:237106660-237106682 CAGTGTCCCTTTTTCAGACATGG + Intronic
923842386 1:237687219-237687241 GTGCATCTCTTTAACAAACATGG - Intronic
924503046 1:244653898-244653920 GAGGTTGCCTTTAACACACAAGG - Intronic
1067179836 10:43976574-43976596 GAGTGTCCCATCAACAAAGAAGG - Intergenic
1073774758 10:106772998-106773020 GAGTATGCCTTAAAAAAACAAGG + Intronic
1080355677 11:31442321-31442343 GGGTGTCCATTTAACAAAAGAGG + Intronic
1080840470 11:35979088-35979110 GAGTGTTGCTTTCATAAACATGG + Intronic
1081052276 11:38358451-38358473 GAGTGTCTCTTTAACTGACAAGG + Intergenic
1086834931 11:91609100-91609122 GAGTGTCCAGTTAAGAAAAATGG + Intergenic
1088630386 11:111768666-111768688 GTGTGTGTGTTTAACAAACAGGG + Intergenic
1088741226 11:112769045-112769067 GAGTGAGCATTAAACAAACAAGG + Intergenic
1088885967 11:114007125-114007147 GACGGTCCCTTTAACATACTGGG + Intergenic
1091544453 12:1492049-1492071 GACTGTCCCATTAACTGACATGG + Exonic
1091609809 12:1996382-1996404 CACTGTCCCTTTAACACACCAGG + Intronic
1097688319 12:62711484-62711506 TAGTGTCCTTTTAACCAAGAAGG - Intronic
1098449751 12:70606974-70606996 GTGTGTCTCTTTAAGAAAAATGG + Intronic
1104461646 12:128961362-128961384 GAGTGGCGCTTTGATAAACATGG - Intronic
1105270401 13:18869296-18869318 GAGTATCCATTTATCAAACAGGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1110933206 13:81249259-81249281 GAATGACCCTTTATCTAACAGGG - Intergenic
1111969410 13:94895530-94895552 TAGTGTCTGTTTCACAAACAAGG + Intergenic
1115214157 14:30997951-30997973 GAGTGTCCATTAAACAAATATGG + Intronic
1120869663 14:89325543-89325565 ATGTTTCCCTTTAACAAAGAGGG - Intronic
1121507189 14:94486166-94486188 GGGCGTCCCTATAACAGACATGG - Intergenic
1121525236 14:94614860-94614882 GAGTTGCTCTTTGACAAACATGG - Exonic
1127324171 15:57878802-57878824 CAGTGTCCCTTCATCAAACTGGG + Intergenic
1128604673 15:69027882-69027904 GGGTGGCCCCTTAACCAACATGG - Intronic
1129645399 15:77425846-77425868 GAGTTTGCCTTTTACAAATAAGG - Intronic
1130336823 15:82963686-82963708 GAGTGTTCCATTAGCAAAGAGGG + Intronic
1130959287 15:88649068-88649090 GAGTGGCCCTTTAGCAGCCAGGG - Intronic
1133690556 16:8210444-8210466 CAGTTTTCATTTAACAAACACGG + Intergenic
1140019684 16:71226341-71226363 GAGAGTCTCTTTAACAAATGGGG + Intronic
1142392881 16:89814265-89814287 GAGTGTCCCTTGGAAAAACATGG - Intronic
1142733410 17:1878854-1878876 CAGTGGCCCTTGCACAAACAGGG - Intronic
1144023464 17:11257229-11257251 GAATGTATTTTTAACAAACATGG - Intronic
1145750973 17:27354575-27354597 GTGCGTCCCTTTAAGACACATGG + Intergenic
1146704863 17:34993826-34993848 GTGGGTCCCTACAACAAACAGGG - Intronic
1152508354 17:80768410-80768432 GAGTATCCTTTTAACATAAAAGG + Intronic
1154417636 18:14190673-14190695 GAGTGTCCATGTATCAAACAGGG + Intergenic
1156399901 18:36730775-36730797 GAGTATGCCTTAAACAAAGAAGG + Exonic
1159421700 18:68229667-68229689 CAGTGTACCTTTAAACAACACGG + Intergenic
1164466698 19:28493143-28493165 GTGTTTCCCTTCATCAAACAAGG + Intergenic
1166015830 19:39978706-39978728 AAGTGTAACTTTAAGAAACAAGG + Intronic
1166463869 19:43015425-43015447 CTGTGTCCCTTTAAGAGACAAGG - Intronic
1167398321 19:49246469-49246491 GAAAGTCTTTTTAACAAACAGGG - Intergenic
925509887 2:4613469-4613491 TAGGGTCCCTTTGACAAAGAGGG + Intergenic
926548500 2:14271837-14271859 GAAAGTCCCTTTAAAACACATGG + Intergenic
926786467 2:16523004-16523026 TAGTGTCCCTGTGACAAACTAGG + Intergenic
928691091 2:33799256-33799278 GAGACTCCTTTTTACAAACAGGG + Intergenic
930100598 2:47600331-47600353 GAGTGGCCCTTCAAAAAGCAGGG - Intergenic
932949185 2:76272591-76272613 GAGTCTCCCATTAGCTAACAAGG + Intergenic
933072977 2:77885282-77885304 GAGTGTCAATTTAAAAAAAAAGG - Intergenic
933343991 2:81060458-81060480 GACTGTCTCTTTAACAACCTAGG - Intergenic
934499605 2:94846644-94846666 GAGTATCCATGTATCAAACAGGG - Intergenic
937661522 2:124435153-124435175 GAGTTTCCCTTAAAAAGACATGG - Intronic
940840189 2:158571005-158571027 GAGTGTCCCTTTCTCACCCAAGG - Intronic
941745399 2:169081553-169081575 GAGTGTACCTATCACACACAGGG + Exonic
943688082 2:190840639-190840661 CATTGTGCCTTTATCAAACAAGG - Intergenic
943736719 2:191364647-191364669 GAGTGACCCTTTGAAATACAAGG - Intronic
944256838 2:197631757-197631779 GAGTGACCCTAGAACAGACATGG + Intronic
946948704 2:224849280-224849302 GAGTGACCTTTTAAAAAAAATGG - Intronic
1169563614 20:6828602-6828624 TAGTTTCCCTTAAGCAAACACGG - Intergenic
1169947296 20:11002925-11002947 AAGTTTCTCTTCAACAAACATGG - Intergenic
1171890838 20:30713351-30713373 GAGTATCCATGTATCAAACAGGG - Intergenic
1172698875 20:36840541-36840563 GAGAGGCCATTTAAGAAACATGG + Intronic
1173638827 20:44584811-44584833 GAGAATCCCTTGAACAAAAACGG - Intronic
1173936456 20:46870371-46870393 AAGGGTCCATTTCACAAACATGG - Intergenic
1173940286 20:46905218-46905240 ATGTGTCCATTTAACAAACATGG + Intronic
1174366796 20:50061392-50061414 GAGTCTCCCTTTAAGACTCAGGG - Intergenic
1176855672 21:13968600-13968622 GAGTATCCATGTATCAAACAGGG - Intergenic
1178395840 21:32242552-32242574 GAGTGACCATTTTACAAACAGGG - Intergenic
1184827743 22:46964426-46964448 GGGCCTCCCTTTAACAAAGAGGG - Intronic
950999041 3:17537051-17537073 GAGTTTCCCCTTAAAAAAGATGG + Intronic
952763227 3:36933966-36933988 GATTGTTCCTTTAGGAAACAGGG + Intronic
954972917 3:54666161-54666183 GAGTTTCCCTTTTATAAATAAGG - Intronic
956019446 3:64918000-64918022 TAGTGTCCATTTAACCAAAAAGG + Intergenic
956623229 3:71241483-71241505 GAGTGTTCCTTTAAGAAAGAAGG - Intronic
959871898 3:111338226-111338248 GATTGGCCCTTTAAAATACAAGG - Intronic
961175528 3:124831945-124831967 GAGTTTCCATTTTACAGACAGGG + Intronic
961970801 3:130965078-130965100 CAGTATCCCTTTAAGAAACTTGG + Intronic
965671275 3:171150416-171150438 GAGTGACCCTTTCACCAAAAGGG - Intronic
966523265 3:180895460-180895482 GTGTCACCCTTTAAGAAACAGGG - Intronic
971051954 4:22871795-22871817 AAGTGTCCATTTCACAGACAAGG + Intergenic
972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG + Intergenic
978503287 4:109432279-109432301 GAGTCTCCCCTTAAGAGACAGGG + Intergenic
978939533 4:114420068-114420090 GAGTTCCCCTTTCAGAAACAAGG - Intergenic
981171738 4:141633112-141633134 GAGTGTACCCATGACAAACAAGG - Intergenic
982242407 4:153313724-153313746 GAGAATCGCTTAAACAAACATGG - Intronic
986251214 5:6060206-6060228 GCCTGTCCCTTTAACAAATGGGG - Intergenic
988083708 5:26445595-26445617 GAGTATACCTTCAATAAACATGG + Intergenic
988470708 5:31534390-31534412 GAGTGTTTCCTTATCAAACACGG - Exonic
991095463 5:62735262-62735284 GAGAGTCTCATTAACAAATAAGG + Intergenic
993416985 5:87647344-87647366 GAATGTTCCTTTAGCAAATAAGG + Intergenic
995851634 5:116552519-116552541 GAGCGTCCCTTTAATGAACCCGG - Intronic
996275185 5:121657447-121657469 GAGTCTCCTTTTAAAAAATAAGG + Intergenic
997354960 5:133256430-133256452 CAGTGTCTCCTGAACAAACAGGG + Intronic
997475227 5:134138767-134138789 TAGTGCCCCTTTGACAGACAAGG - Intronic
999551726 5:152694893-152694915 GACTGACCTTTTAACAAAAATGG - Intergenic
1000798920 5:165700066-165700088 GTGTGCCACTATAACAAACATGG + Intergenic
1009302194 6:62038727-62038749 AAGTTTCTCTTTAAAAAACATGG + Intronic
1009821695 6:68810826-68810848 GAGTGTATCTTTAAAACACAAGG + Intronic
1012742479 6:103036254-103036276 GAATGTCCCTTCAACAAATTTGG - Intergenic
1016685036 6:146871285-146871307 GAATTTCCCTTTCACAAAAAGGG - Intergenic
1016831684 6:148440273-148440295 GAGTGTCACTTAAAAAAAAAAGG - Intronic
1016949737 6:149567438-149567460 AAGTGTCACTTTGACCAACAAGG + Intronic
1021256097 7:18394201-18394223 GAGTGTCCCTTTAACAAACAAGG - Intronic
1023193173 7:37605141-37605163 GATTGGCCCTTTAACAAAATGGG + Intergenic
1031206606 7:118766793-118766815 GAGTGTCTATTTTACAAACAGGG + Intergenic
1032690720 7:134283680-134283702 GAGTGTACCAATAACAAACTTGG + Intergenic
1036410820 8:8498764-8498786 GACTGTCCCTTTAAAAAACAAGG - Intergenic
1038348720 8:26756772-26756794 GTGTGTCCCTTTAAAACACAAGG + Intronic
1039893260 8:41698517-41698539 AAGTGTCCCATGAACAAGCAGGG - Intronic
1041461967 8:58120915-58120937 GAGTGTCCCCATAAGAAACATGG + Intronic
1041526790 8:58815490-58815512 GACTGTCTCTATAGCAAACATGG - Exonic
1043507294 8:80915179-80915201 GGGTTTCCGTTTAACAATCAAGG + Intergenic
1043788799 8:84436518-84436540 GAGTGTCTTTTCAACAATCATGG + Intronic
1054358014 9:64082402-64082424 GAGTATCCATGTATCAAACAGGG + Intergenic
1055770616 9:79713412-79713434 GAGTGGCTCTCCAACAAACATGG - Intronic
1060626735 9:125120274-125120296 GAGTTTTCCTGTAAAAAACAAGG + Intronic
1061335707 9:129933651-129933673 CAGTGTTCCTTTAACATAAAAGG - Intronic
1203560448 Un_KI270744v1:51119-51141 GAGTATCCATGTATCAAACAGGG - Intergenic
1186120609 X:6357340-6357362 GAGTGACCCTGTAACAACGAAGG - Intergenic
1188823664 X:34803800-34803822 GTCTTTCCCTTTAACAAATAAGG - Intergenic
1190528925 X:51355308-51355330 TAGTGTCCTTTTAGAAAACATGG - Intergenic
1193734490 X:85140821-85140843 TATTGTCCCTTTAATTAACATGG + Intergenic
1195458013 X:105091213-105091235 GAGTGACCCTTTACAAGACATGG + Intronic
1197366105 X:125566619-125566641 GTGGGTCCCTTTAAGAGACAGGG + Intergenic
1198491527 X:137146153-137146175 GAGTTTCACTCTAACAGACATGG - Intergenic
1200878130 Y:8180955-8180977 GATTGTCCCTTGAACTAACTCGG - Intergenic
1202241030 Y:22770304-22770326 GTGTGTTTCTTTAACAGACACGG + Intergenic
1202394016 Y:24404047-24404069 GTGTGTTTCTTTAACAGACACGG + Intergenic
1202476769 Y:25266045-25266067 GTGTGTTTCTTTAACAGACACGG - Intergenic