ID: 1021259600

View in Genome Browser
Species Human (GRCh38)
Location 7:18438154-18438176
Sequence CTGAATATAAACATGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 9, 3: 66, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021259600 Original CRISPR CTGAATATAAACATGAACAA AGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
907023475 1:51092002-51092024 CTGAATACAAACATATAAAAAGG + Intergenic
907346658 1:53787346-53787368 CTGAATATAAAAAGAAATAAAGG + Intronic
907536146 1:55160026-55160048 CTGAATATAAACACAGACCATGG + Intronic
908543147 1:65140495-65140517 CAGCAGATAAACGTGAACAAGGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909135088 1:71788063-71788085 CAGAATATTAACATGAATCATGG - Intronic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909317157 1:74237578-74237600 CTGAATATTAGGATTAACAATGG + Intronic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
911643398 1:100313141-100313163 ATGAATCTTAACATAAACAATGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
913413637 1:118580385-118580407 GTGGATATAAACTTGAACCATGG + Intergenic
914457430 1:147849069-147849091 GTTAATATTAACATTAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917112234 1:171560186-171560208 CAGAATATCAACATTAACAGGGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918240485 1:182616113-182616135 CAGAATACAGACAAGAACAAAGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
918834068 1:189436887-189436909 CTGAAAATAAAAATAAAAAATGG - Intergenic
919100432 1:193090148-193090170 CAGAATATATGCTTGAACAAAGG + Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919468792 1:197953438-197953460 ATGAATAAATACATGAAAAAGGG + Intergenic
919861772 1:201743772-201743794 CTGAATAGAAACCTGAATATGGG - Intronic
920164464 1:204025954-204025976 GTGAATACAAAAGTGAACAAGGG + Intergenic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
921897422 1:220414968-220414990 GTAAATATAAACATGTACTATGG - Intergenic
922020465 1:221699294-221699316 CTGACAAAAAACATGTACAAGGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922401910 1:225268028-225268050 CTGGGTATAAGCAGGAACAAAGG + Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924209908 1:241754067-241754089 CAGATTAGAAAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924275079 1:242377693-242377715 CTCAATTTAAAAATGAGCAAAGG + Intronic
1063568768 10:7195560-7195582 CAGACTCTAAACACGAACAAGGG + Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063885607 10:10575016-10575038 TTGAATTTAAACATTAACATAGG - Intergenic
1065238939 10:23686204-23686226 CTGACTATAGACATTTACAAAGG + Intergenic
1066201048 10:33142941-33142963 CAGAAATTAAACATGAACCAGGG + Intergenic
1066409037 10:35147824-35147846 CTGAATATGAACATTACCAAGGG - Intronic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068711936 10:60144697-60144719 CAAAATAGAAACAGGAACAAAGG + Intronic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1068956193 10:62819969-62819991 TTGAATACAAACATGTACCATGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070368902 10:75763044-75763066 TTGAAGATAGACATGAAAAAAGG - Intronic
1070808421 10:79284814-79284836 CTGAATATTAACCTCAAAAAGGG + Intronic
1071049447 10:81428672-81428694 CTGAAGATAAACATGAGCATTGG + Intergenic
1072820500 10:98551836-98551858 CTGAATATAAACATCATCTAAGG + Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1073617756 10:105015008-105015030 CAGAAAATTAACATGAAAAAAGG + Intronic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075248111 10:120842345-120842367 CTCAATATAAAAATAAGCAAAGG + Intergenic
1076945675 10:133648024-133648046 TTTACTATAAAAATGAACAAAGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1080108658 11:28540757-28540779 CTGAGTAGTAACAAGAACAAAGG - Intergenic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080373786 11:31684121-31684143 TTGAATATAAACATAAACTCTGG - Intronic
1081068552 11:38578887-38578909 CTGAATATTACCATAAACAATGG + Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1082923861 11:58524970-58524992 GTGAATATAAACATATAGAAAGG - Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1084976704 11:72804342-72804364 CGCAATATAAAAATGAGCAATGG - Intergenic
1084990312 11:72916616-72916638 CCCAATATAAAAGTGAACAAAGG - Intronic
1086048201 11:82557955-82557977 CTGAACAAAAACATGAAGCAGGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086971137 11:93082351-93082373 GAGAATATAGCCATGAACAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087252779 11:95922802-95922824 CTGAACATCAACAGGAAAAAAGG + Intronic
1087611600 11:100441059-100441081 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1088093547 11:106072989-106073011 GTGGAAATAAAAATGAACAATGG + Intronic
1088155163 11:106793671-106793693 CCCAATTTAAAAATGAACAAAGG + Intronic
1089311981 11:117564362-117564384 GTGAATAAAAACAATAACAAAGG - Intronic
1089718399 11:120387103-120387125 CTGAATAGAATCATGAACCAAGG - Intronic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090578851 11:128138243-128138265 CTGAATATTAACATAAATGATGG + Intergenic
1091664290 12:2407867-2407889 CTTAATATAAAAATAAGCAAAGG - Intronic
1093428252 12:19053853-19053875 CTAATTATAAAAAAGAACAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093524113 12:20087392-20087414 CTGAAAACAAGCATGAAAAATGG + Intergenic
1094073097 12:26441109-26441131 CTGAATGTAAACATTAAAATGGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097423415 12:59411041-59411063 ATGACTATAAACAGAAACAAAGG - Intergenic
1097424440 12:59425213-59425235 ATGAATAACAATATGAACAATGG - Intergenic
1098400286 12:70067518-70067540 CTGAATGCAAACATAAACAATGG - Intergenic
1098563151 12:71900855-71900877 TTGAATAGAAACTTGAAAAAGGG + Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1099639228 12:85263519-85263541 CTGAAAATAAACAGTGACAAAGG + Intergenic
1100179718 12:92072302-92072324 CTGAATTCAAACTTGAATAATGG - Intronic
1100192413 12:92207092-92207114 CTGTATAATACCATGAACAAAGG - Intergenic
1100791940 12:98140093-98140115 CTAAATATGAATATGAATAACGG + Intergenic
1102854416 12:116280390-116280412 CCTAATAGAAACATGAATAAAGG + Intergenic
1102963474 12:117108854-117108876 CTGAATTTAAATAAGAACCAAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106268387 13:28130607-28130629 CTGGATATGAACAAGAACATGGG - Intergenic
1106389135 13:29318431-29318453 CTGAACATAAACAAGAATAACGG - Intronic
1106460972 13:29968215-29968237 CTGAATATATACATTAGGAAAGG + Intergenic
1106807696 13:33327670-33327692 CTGATTATAAAAATCACCAAAGG - Intronic
1106837379 13:33649523-33649545 CCGAATATAAACATCATAAAGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107072614 13:36287276-36287298 CTGAAAATAAAAAATAACAAGGG + Intronic
1107100433 13:36584910-36584932 CTAAAGATAAACAGGAAAAAAGG - Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108214689 13:48172726-48172748 ATAAATATAAACATTAACAGTGG + Intergenic
1108899597 13:55384293-55384315 CTGAATATCTCCATGAAAAAAGG + Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109280844 13:60353294-60353316 CCCAATTTAAAAATGAACAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111524880 13:89455645-89455667 CTGCATATAACCATGAAAGATGG + Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112823203 13:103359725-103359747 CCTAATTTAAAAATGAACAATGG + Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1113604247 13:111594409-111594431 CTGAATATAAACGTAAAAAGTGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116880964 14:50168551-50168573 CTGACTAAAAAAATGAGCAAAGG - Intronic
1117189949 14:53279670-53279692 ATGAATAAAAACATGATCTATGG + Intergenic
1117326777 14:54676253-54676275 CTGAGTACAACCATGAAAAATGG - Intronic
1117539780 14:56735543-56735565 CTCAATATAAACATGTACTGTGG - Intergenic
1117609371 14:57466196-57466218 TCCAATATAATCATGAACAAAGG - Intergenic
1117678301 14:58177630-58177652 CTGAACATAAATATGACCTAGGG + Intronic
1118673554 14:68157697-68157719 CTGAATAAAAACAATAATAATGG + Intronic
1118895489 14:69942233-69942255 ATGAAAATAAACAAGAACACAGG - Intronic
1119565689 14:75627304-75627326 CTCTATAGAAACAAGAACAATGG + Intronic
1119894257 14:78206510-78206532 CTGTAAATAAAGAGGAACAAAGG + Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121678566 14:95774145-95774167 CTGTATAAAACCTTGAACAAGGG - Intergenic
1122106888 14:99464664-99464686 CATAATCTAAACATGGACAAAGG + Intronic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1124056758 15:26247457-26247479 CTCAATTTAAAAATTAACAAAGG - Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1124237461 15:28002771-28002793 CAAAATATCAACAAGAACAAGGG - Intronic
1125529984 15:40406747-40406769 CTGGCTATAAACATAAACTACGG - Intronic
1125879640 15:43182849-43182871 ATGAATGTAAACATTTACAAAGG - Intronic
1126590016 15:50329636-50329658 TTGAAGACAAACTTGAACAATGG - Intronic
1126958531 15:53962904-53962926 CTGAATTTTATCATGTACAAAGG - Intergenic
1127582627 15:60351555-60351577 CAGAATATAAAACTGAAGAAAGG - Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1128722679 15:69962839-69962861 CAAAATATCAACATGAACAGGGG + Intergenic
1129013771 15:72447388-72447410 ATAAATATAAACAAAAACAAAGG + Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1130867719 15:87946643-87946665 CTGAGTATCAACATGAGCCAGGG - Intronic
1135108060 16:19668152-19668174 CTGAATTAAAACAGGAACACCGG - Intronic
1135425477 16:22331810-22331832 TTGAATATAAATAAAAACAAAGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135609611 16:23854858-23854880 CTGAAAATGAACTTGATCAAAGG + Intronic
1135698191 16:24609146-24609168 GTGAATGAAAACATGAGCAAAGG + Intergenic
1136155297 16:28378043-28378065 CAGCAGATAAACGTGAACAAGGG - Intergenic
1136207786 16:28737246-28737268 CAGCAGATAAACGTGAACAAGGG + Intergenic
1137315812 16:47321295-47321317 CTGAATATAGACAGAAATAATGG + Intronic
1137425773 16:48379362-48379384 CTAAATACAATCATGACCAAAGG + Intronic
1137852944 16:51764367-51764389 CTTAAAACAATCATGAACAATGG - Intergenic
1138252342 16:55510792-55510814 CTAAATTTAATCTTGAACAATGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138390393 16:56666471-56666493 CTGAGAATAAACATGAGGAATGG + Intronic
1138391263 16:56671376-56671398 CTGAGAATAAACATGAGGAATGG - Intronic
1138923566 16:61563556-61563578 GGGAACATAAACATAAACAAGGG - Intergenic
1139289949 16:65848889-65848911 ATGAGTATAAATATGAAAAAAGG - Intergenic
1139680432 16:68557550-68557572 GTGTTAATAAACATGAACAAGGG + Intronic
1139831707 16:69804029-69804051 TTCAATATAAAAATGAGCAAAGG - Intronic
1140774112 16:78234188-78234210 CTGTATATTAACATTCACAAAGG - Intronic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1143821082 17:9563771-9563793 ATGAATAAAAACAGAAACAAAGG + Intronic
1143823271 17:9582476-9582498 CTCAATAGAAAAATGAGCAAAGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144224659 17:13133177-13133199 CCAAATATAAACATTACCAATGG - Intergenic
1144507991 17:15849662-15849684 ATGAAGATAAACATGACTAAAGG - Intergenic
1145172115 17:20667294-20667316 ATGAAGATAAACATGACTAAAGG - Intergenic
1147207336 17:38847032-38847054 CAGAATATAAACAGTGACAAAGG + Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1153038529 18:788048-788070 CAGAATATAAATATGAGGAATGG - Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154227461 18:12519643-12519665 CTCATTAGAAAAATGAACAAAGG + Intronic
1155335460 18:24760099-24760121 CAGAATATATACATGAATTAGGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156420731 18:36949703-36949725 CTGAACAAAAACATGAGCCACGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159680167 18:71340134-71340156 CTGAAAGTAAACAAGAAAAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1164957235 19:32397081-32397103 GTTAATATAAAGTTGAACAAAGG + Intergenic
1165836692 19:38761535-38761557 CTGAATAAAAACAAAAACACAGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167975078 19:53219618-53219640 CTTAATGTAAACATGAACTTTGG - Intergenic
925720945 2:6826490-6826512 CTGAATAGAGACCTGAACCAAGG + Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927244815 2:20949261-20949283 AAGAATTTAAACATGAAAAATGG - Intergenic
927560716 2:24070930-24070952 CTGAATATAAGCTTGAAGGAAGG - Intronic
928265603 2:29808896-29808918 CTGTACATAAAGATGAATAATGG - Intronic
928636674 2:33253735-33253757 CTGGTTCTAACCATGAACAAAGG - Intronic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929801491 2:45108252-45108274 CTGAATATCAACTTGAGCAGAGG - Intergenic
929837430 2:45418247-45418269 CTGAATGAAGGCATGAACAATGG + Intronic
930535025 2:52635266-52635288 ATAAATAAAAACATGAATAAAGG - Intergenic
930897017 2:56458405-56458427 CTGAATAAATACAGGACCAAAGG - Intergenic
932125654 2:69143510-69143532 CTGAATACAACCCTGAAGAATGG + Intronic
932169658 2:69542394-69542416 CAGAATATAAACATAAAAACAGG + Intronic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933343362 2:81050566-81050588 CTGAATATCAATATTAAAAATGG + Intergenic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933443171 2:82340852-82340874 CTGAAAGAAAACAAGAACAAAGG + Intergenic
933483727 2:82891451-82891473 CTGAAAATAAAAATAAATAAGGG - Intergenic
933525137 2:83427898-83427920 CTGATTTTAAAAATGAGCAAAGG + Intergenic
933660606 2:84924549-84924571 CCTCATATAAACATGAATAAAGG + Intergenic
933681968 2:85109941-85109963 CTGGATATAAAAATCAACATGGG - Intergenic
934559962 2:95307934-95307956 CTGAATAAGATCATGAATAATGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936953444 2:118001382-118001404 CAGAATATTAACATGAAACATGG + Intronic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938074596 2:128325021-128325043 CTGAATACAATCATGCACAGAGG - Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938860031 2:135358722-135358744 CTGAATATAAGAATAAGCAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939574556 2:143880684-143880706 CAGACTATAAAAATGAACATGGG + Intergenic
939809723 2:146815928-146815950 CCCAATTTAAAAATGAACAAAGG - Intergenic
940103287 2:150067747-150067769 CCCAATTTAAAAATGAACAAAGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940142333 2:150506339-150506361 CTGGATAAAAGCTTGAACAATGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941367901 2:164629156-164629178 GTGAATATAATCAAGAAAAAAGG - Intergenic
942811132 2:180002366-180002388 CTGAATATAAATATCAATTATGG - Intronic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943221765 2:185118751-185118773 CTGAACTAAAACATGAACATAGG + Intergenic
943714306 2:191133515-191133537 CTGCATATATACATGTATAAGGG + Intronic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943977011 2:194495454-194495476 ATGAATATAATGATGAACTATGG - Intergenic
944637485 2:201688919-201688941 ATGAATTTAAACAATAACAAGGG + Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
946799432 2:223395571-223395593 TTGAATAGAAATGTGAACAAAGG + Intergenic
947585773 2:231355775-231355797 CTGGAGAAAAACATGAAAAACGG - Intronic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
1169054235 20:2607145-2607167 CTTTATATAAAAATGAACAGTGG - Intronic
1170563609 20:17579995-17580017 CAGAATATAAAGATGAATACAGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172991332 20:39039109-39039131 CTGCAGATAAACAGGGACAAGGG - Exonic
1174400040 20:50271047-50271069 CTGAATACAAAAAAGATCAAGGG + Intergenic
1175296149 20:57910106-57910128 CTGAGTGTGAATATGAACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176095832 20:63343973-63343995 CAGAAAATAAACATGCATAACGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176740900 21:10600996-10601018 CTGAATTTAAAAAATAACAACGG - Intronic
1176994807 21:15543190-15543212 CTAAATATATATTTGAACAAAGG - Intergenic
1177254369 21:18641064-18641086 CTGAAAATAAACTTGAAAGATGG - Intergenic
1177278729 21:18950680-18950702 CTCAATATAAAAATGAGAAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177764563 21:25442157-25442179 CTGAATATAAACAGGCTAAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1184699786 22:46162908-46162930 CTGAATAAATACATGAACTGAGG - Intronic
949124624 3:432279-432301 GTGATTATAAACATGAATATAGG - Intergenic
949354440 3:3163324-3163346 CTGAATATGAAAATAACCAAGGG + Intronic
949567247 3:5256345-5256367 CTGAATACATGCATGAGCAATGG + Intergenic
949720123 3:6979205-6979227 ATTAATGTAAACATTAACAAGGG + Intronic
951233011 3:20201345-20201367 CTGAACATAAACACCAACACTGG + Intergenic
951852580 3:27158670-27158692 CTAAATAAAAACCTGAGCAAGGG + Intronic
951946297 3:28140586-28140608 CTGAATACTTACATGAACACAGG + Intergenic
952443696 3:33359560-33359582 CAGACTATAAACATAAACAAGGG - Intronic
952567331 3:34674748-34674770 CTGAGTATAGACCTGAAGAAAGG + Intergenic
952705633 3:36374933-36374955 CTGAATAAAACAATGACCAATGG + Intergenic
953016859 3:39085606-39085628 CTGAATATAAAAACTAACCATGG - Exonic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953562317 3:44001105-44001127 CTGAATCTTAACATGAGAAACGG + Intergenic
953813821 3:46136779-46136801 CCCAATTTAAAGATGAACAAAGG - Intergenic
953940427 3:47090336-47090358 CTGAACAGAATCCTGAACAAGGG + Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
954932059 3:54292491-54292513 CACAATTTAAAAATGAACAAAGG + Intronic
955049186 3:55392550-55392572 CAGCATATAAACAGAAACAACGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956867611 3:73384931-73384953 CTGCATAAACACAAGAACAAAGG + Intronic
957400997 3:79713428-79713450 CAAAAGGTAAACATGAACAAAGG + Intronic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957476791 3:80735866-80735888 CAAAATATCAACATTAACAAAGG + Intergenic
957495457 3:80986034-80986056 CTGTATATTACAATGAACAATGG - Intergenic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
957862565 3:85974115-85974137 ATAAATATAAACATGTACACGGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960934345 3:122888272-122888294 TTGAATACTAACAAGAACAAAGG + Intergenic
961096958 3:124165736-124165758 ATGAATATAAATATATACAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961522849 3:127477336-127477358 TTTAATTTAAACTTGAACAAAGG + Intergenic
961617034 3:128190815-128190837 CTGTATCTAAACATAAAAAAGGG - Intronic
963389809 3:144646663-144646685 CTCAATTTAAAAATGAGCAAAGG - Intergenic
963608962 3:147441220-147441242 CTGAACATGAACATGAATAAGGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964933503 3:162053297-162053319 CTGAACAGAACCATGATCAATGG - Intergenic
965117326 3:164507660-164507682 ATGAATTTAATCATCAACAAGGG + Intergenic
965501753 3:169464781-169464803 ATGATTATGACCATGAACAATGG - Intronic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
965916205 3:173849472-173849494 CTGAATATAAACATTAGCAGAGG + Intronic
967232019 3:187348240-187348262 CCCAATTTAAAAATGAACAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968195687 3:196704269-196704291 CCCAATAAAAAAATGAACAAAGG + Intronic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969522149 4:7684651-7684673 CTGAATATAAACCTGTCAAACGG - Intronic
969589657 4:8114595-8114617 CTGATTATAACCATGAACCGAGG + Intronic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970124125 4:12790225-12790247 TAGAATAAAAAGATGAACAAAGG - Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
971224893 4:24742898-24742920 CTGAATGTACACGTGAACAGTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971925158 4:32999351-32999373 GTGAGTATAAAAATGAAAAAAGG - Intergenic
972137128 4:35906106-35906128 ATCAATATAAACATGTAAAAGGG - Intergenic
972187464 4:36548327-36548349 CTAAATATAAACATCAAAATTGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974486579 4:62513380-62513402 TTGAATATATACACCAACAATGG + Intergenic
974819353 4:67046230-67046252 CTGAATATAAATTTTAAAAAGGG - Intergenic
975044880 4:69790072-69790094 GTGAATATAAAAATAAAAAAAGG - Intergenic
975064567 4:70044623-70044645 CTAAATAAAAACATAAACATTGG + Intergenic
976525985 4:86089295-86089317 ATGAAGATAAACAAGAACACAGG + Intronic
977067686 4:92339567-92339589 TGGAATTTAAACATGAGCAAAGG + Intronic
977798425 4:101196235-101196257 CTGAATTAAAATATGATCAAGGG + Intronic
979050646 4:115927208-115927230 CAGAATATAAAAATCAACTATGG + Intergenic
979537851 4:121844083-121844105 ATGAATATAAACTAGAACTAAGG - Intronic
979884684 4:126011792-126011814 CTGAATCTTAACATCTACAATGG - Intergenic
979954457 4:126934996-126935018 CTGAATATGTACATCTACAATGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981705285 4:147652896-147652918 AAGAATATAAATATGAAAAAAGG + Intronic
981818534 4:148859354-148859376 CTGTATATAAAAATCAGCAATGG + Intergenic
981874973 4:149531037-149531059 TTGAATATATACATGAAGTATGG - Intergenic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982750941 4:159161120-159161142 CTGGATGTAAACATTAAAAACGG + Intronic
982918762 4:161248952-161248974 CTGAACAAAAACTTGAGCAAAGG - Intergenic
983223727 4:165067112-165067134 TTGAATATAAACATTAAAATGGG + Intergenic
983276619 4:165625367-165625389 CTAAATATAAAAATGAAATAGGG + Intergenic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
984082846 4:175270385-175270407 CTGAATCTAAATAAAAACAATGG - Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987865461 5:23529775-23529797 ATGAAAATAAACAAAAACAAAGG + Intergenic
988022757 5:25644563-25644585 GTGAAAATAAACATCAACACAGG + Intergenic
988151339 5:27385801-27385823 CTGAAAATAAACAGCAACACAGG - Intergenic
988861508 5:35285325-35285347 ATGGATATATACATGAACTATGG + Intergenic
989446058 5:41530026-41530048 CTGATTTTAAAAATGAGCAAAGG + Intergenic
989784980 5:45316283-45316305 CAGAATATAAACAGAACCAAAGG + Intronic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
992307593 5:75459323-75459345 CTGAAGATAAGAATGTACAAAGG + Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993048970 5:82903081-82903103 CTGAATCTAAGTAAGAACAATGG - Intergenic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993418793 5:87673556-87673578 GTGAAAATAAATATGAAAAAGGG - Intergenic
993446681 5:88021109-88021131 GTGTATATATACATAAACAATGG + Intergenic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
995170186 5:109100758-109100780 TTTATTATAATCATGAACAACGG + Intronic
995380551 5:111527737-111527759 TTGAATATAAACATGAAACAAGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997306365 5:132839847-132839869 GTGAAAATAAACAAGAACAAAGG - Intergenic
998106824 5:139474024-139474046 CAGAATATAAAAAGGAACAGAGG + Intergenic
998305818 5:141076193-141076215 GTGAATGTAACCATGTACAAAGG - Intergenic
999146509 5:149399423-149399445 CTGGACATAAACAAGAAAAATGG + Intronic
999221764 5:149985588-149985610 CTGAATATAAAAGTGAGAAAAGG + Exonic
999634506 5:153606938-153606960 CTGAATACCAAATTGAACAAGGG - Intronic
1000010016 5:157222250-157222272 CTCAATATGGACATGAAGAAAGG + Intronic
1000469193 5:161618986-161619008 TCCAATATAAACATGGACAAAGG + Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1001583817 5:172819301-172819323 ATGATTCTAAATATGAACAATGG + Intergenic
1002110773 5:176910060-176910082 GGGGATATAAACATGAACTAAGG + Intronic
1002121073 5:177005477-177005499 CTGAATATAAACTGAAAAAATGG - Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1003797292 6:9619059-9619081 CTGGCTACAAATATGAACAATGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004465140 6:15878266-15878288 TTGAAAATAAACATGAAACAAGG - Intergenic
1004850025 6:19689902-19689924 CTGAATATTAACATTGAAAATGG + Intergenic
1005152770 6:22771884-22771906 CCGAAGATGAAAATGAACAAAGG + Intergenic
1005215030 6:23516034-23516056 CTTAATATAAAGTGGAACAAAGG + Intergenic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1007047215 6:38788607-38788629 CTCAATTTAAAAATGAGCAAAGG - Intronic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1008136860 6:47787015-47787037 ATTAAAATAAACATCAACAAAGG + Intronic
1008764410 6:54893793-54893815 CTGCATATAAATATTATCAAAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009382037 6:63043819-63043841 CTTAAAATAAACATTAAAAAAGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009603366 6:65833388-65833410 CCCAATGTAAACATGAAGAATGG - Intergenic
1009861250 6:69335880-69335902 CTGATTATAAAAAAGAAGAAAGG - Intronic
1010079637 6:71845062-71845084 CGGAATTTAAAGATAAACAAAGG - Intergenic
1010689006 6:78887202-78887224 CTGATTTTAAAAATGAACGAAGG + Intronic
1010745166 6:79552416-79552438 CAGATTATAAACAGGACCAAAGG - Intergenic
1010907568 6:81510579-81510601 CTCAATTTAAAAATGAGCAAAGG - Intronic
1010993218 6:82502943-82502965 CAGATTATAAATATGAAGAATGG - Intergenic
1011052200 6:83164790-83164812 CTGAATGTCAACAAGTACAAGGG + Intronic
1011109863 6:83825401-83825423 CATAATATAAACATGACCAGGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011681452 6:89787344-89787366 TTGGATATAAGCATGAACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012084785 6:94810357-94810379 ATGAAAATAAACATAAAAAAAGG - Intergenic
1012442671 6:99276081-99276103 CTGCATATAAAGGAGAACAAAGG + Exonic
1012789021 6:103668665-103668687 CCCAATTTAAAAATGAACAAAGG - Intergenic
1012880269 6:104779030-104779052 GAAAATAAAAACATGAACAAAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014488553 6:122033001-122033023 GTGAAAATAAATAGGAACAAAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015781586 6:136873053-136873075 TTGAATACAAACAGAAACAAAGG - Intronic
1015977209 6:138802468-138802490 CTCCATATAACAATGAACAAGGG + Intronic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016185979 6:141197710-141197732 GTGAAGATAGACATGAACACAGG - Intergenic
1016814467 6:148290774-148290796 CAGCAGATAAACATGAACAAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017292395 6:152754881-152754903 CTGAATAAAGACATTCACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020833417 7:13119603-13119625 CAAAATATAAATATTAACAAGGG + Intergenic
1020838624 7:13185887-13185909 CGCAATCTAAAAATGAACAAAGG + Intergenic
1020976443 7:15012852-15012874 GTGAATATTAACATGACTAAGGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021591496 7:22268582-22268604 CAGATTATAAACATTCACAAGGG + Intronic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022052417 7:26690363-26690385 CTGTAAATAAACATTATCAATGG + Intronic
1023112589 7:36828781-36828803 CTGAATGGAAATAAGAACAAAGG - Intergenic
1023372360 7:39524461-39524483 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023794677 7:43781906-43781928 CTGGATATAGGCAAGAACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027598216 7:80202918-80202940 CTAAACAGAAACATGAATAATGG - Intronic
1028074185 7:86490964-86490986 CTGAATATTAATATGTACATTGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028904808 7:96140928-96140950 CTGATTTTAAAAATGAGCAAAGG - Intronic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1030926888 7:115468341-115468363 ATGAATATAAACAGGCACACAGG + Intergenic
1031407778 7:121406653-121406675 CTGAGTTTAACCAGGAACAATGG + Intergenic
1031429173 7:121645291-121645313 TTGATTATAAACAAGGACAAGGG - Intergenic
1031474075 7:122201981-122202003 AAGAACACAAACATGAACAAGGG + Intergenic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032648611 7:133853734-133853756 ATGAATACAAACATGAGCATGGG - Intronic
1032667629 7:134052545-134052567 GATAATATATACATGAACAATGG + Intronic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1035555969 8:567483-567505 CTGAGCACAAACATGAACAAGGG - Intergenic
1035956763 8:4088891-4088913 CTGAATATAAAAATGAGTAGAGG - Intronic
1036199802 8:6760097-6760119 AAGAATATAATTATGAACAAAGG - Intergenic
1039215087 8:35260746-35260768 TTAAATATAAACTTGAACAATGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041102096 8:54406709-54406731 GTGAATATAAACATGAAATTGGG + Intergenic
1041661497 8:60405753-60405775 CTGACTATAAACATTAACAAAGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042029378 8:64459022-64459044 CTGAATGCAAACATGAAAAGAGG + Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042794302 8:72643754-72643776 CTGGACTTATACATGAACAAAGG + Intronic
1043235285 8:77857347-77857369 TTGAAAATAAAGATAAACAAAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043436886 8:80243872-80243894 CTGAATATAAGCATCAACTCAGG + Intergenic
1044129121 8:88498319-88498341 CTGAAGATAAACCGGAAAAATGG + Intergenic
1044232155 8:89791075-89791097 CTAAATATAAGCAGGAAGAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044288519 8:90439525-90439547 CTGAATATAAACAAAAGGAATGG + Intergenic
1044291316 8:90473951-90473973 CTGACTTTGAATATGAACAAGGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045061631 8:98416459-98416481 TTTAATATAAACAAGAGCAAAGG + Intronic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045789491 8:105965657-105965679 CTGATTATAAACTGGAACACTGG + Intergenic
1046558777 8:115811896-115811918 CTGATTAAAAAAATGAAAAAAGG + Intergenic
1046927571 8:119808476-119808498 CAAAACATCAACATGAACAAGGG - Intronic
1047052717 8:121130786-121130808 CTGTAAATAAACTTAAACAAAGG - Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047846153 8:128807589-128807611 GTGAATATAATCATGAACTGAGG - Intergenic
1047934441 8:129763058-129763080 GTGAATATTAACTTGAACATGGG - Intronic
1047988844 8:130264709-130264731 ATGAATATGAACATGAGAAAGGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050655798 9:7827531-7827553 CTGAAGAGAATCATGAACTATGG + Intronic
1050994682 9:12201201-12201223 TTGAATACAAACTTTAACAAAGG - Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051244797 9:15099082-15099104 CTAAAGATAAATGTGAACAAAGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1052200494 9:25772748-25772770 ATAAATATAAACTTGAAAAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055054461 9:72010975-72010997 CTGCATTTTAACATAAACAATGG + Intergenic
1055143219 9:72900186-72900208 CTGAATATAAACCTTAATAATGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055856630 9:80696294-80696316 CTGTATATAAACAGGAGCTAAGG + Intergenic
1056235680 9:84591670-84591692 GTAAATATAAACATTAACACTGG - Intergenic
1057425683 9:94947542-94947564 CTGAATGTAAAAATGAAATATGG - Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060590727 9:124814848-124814870 CTAAATAAAGACATGATCAAAGG + Exonic
1061329676 9:129884760-129884782 CTGAATTTAAAACAGAACAAAGG - Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186902320 X:14070090-14070112 CTGAATACAAAAATAAGCAAAGG + Intergenic
1186913696 X:14197090-14197112 CTGAATATAAAATAAAACAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188402729 X:29767102-29767124 AAGAATATAAATATCAACAAAGG - Intronic
1188559236 X:31449241-31449263 CTGAATGAAAACATGAATTAAGG + Intronic
1188597167 X:31915631-31915653 CTGAATGTATACATAAACCAAGG + Intronic
1188871044 X:35372635-35372657 CTGAATATATACCTAAAGAAAGG - Intergenic
1188922936 X:36001355-36001377 ATGAATATAAATAGGAATAAAGG - Intergenic
1188929210 X:36085469-36085491 CTGTAGATAACCATGAAAAAAGG + Exonic
1189104960 X:38226023-38226045 TTAAATATAAACATGACCATGGG + Intronic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189708160 X:43780399-43780421 AAGAATATAAACAAGAAAAAGGG + Intronic
1190906989 X:54737290-54737312 CAGCAGATAAACGTGAACAAAGG - Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191836827 X:65472208-65472230 CTCAATTTAAAAATGAATAAAGG - Intronic
1192480983 X:71485671-71485693 CCAAATCTAAAAATGAACAAAGG - Intronic
1193649423 X:84111357-84111379 CAGAATACAAACATGACCGAGGG + Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194621143 X:96174290-96174312 CTGAATAAAAACATAATAAAAGG + Intergenic
1194678536 X:96822888-96822910 CCTAATAGAAATATGAACAAAGG + Intronic
1194897629 X:99464764-99464786 CCCAATTCAAACATGAACAAAGG - Intergenic
1194988696 X:100520926-100520948 ATGAACATGAACATGAACATGGG - Intergenic
1195297414 X:103492675-103492697 CTGAAGATAAACTTGTTCAAGGG + Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1195597900 X:106713728-106713750 CAGTATATGAACATGAACATGGG + Intronic
1195961380 X:110390652-110390674 CTGAAACTAAACATGATCTAAGG - Intronic
1196311934 X:114178495-114178517 CTGAAAATCAACAATAACAATGG - Intergenic
1197014570 X:121608068-121608090 CTGTATTTAAATATGAACAGTGG - Intergenic
1197014720 X:121609613-121609635 GTAAATATAAACAAGAACAAAGG + Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1197767052 X:130066147-130066169 CTGAATCTCGGCATGAACAAAGG + Exonic
1200781877 Y:7224108-7224130 ATGAATATAAACATGGAACATGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic