ID: 1021261410

View in Genome Browser
Species Human (GRCh38)
Location 7:18462192-18462214
Sequence CTGGCGGGTGACTGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021261410 Original CRISPR CTGGCGGGTGACTGTGAAGA TGG (reversed) Intronic
903215706 1:21842261-21842283 CGGGACGGTGACTGTGAAGGAGG + Exonic
905929044 1:41773492-41773514 CGGGAGGGTGTCTGGGAAGAAGG - Intronic
906260973 1:44389817-44389839 CCAGGGGGTGACTGTGAAGGCGG + Intergenic
907253057 1:53156039-53156061 CTGGCAGGTCACTGTGCACACGG + Intergenic
908508409 1:64829147-64829169 CTGGCTTCTGACAGTGAAGATGG + Intronic
910603960 1:89062983-89063005 ATGGAGGCTGACTGTGTAGATGG + Intronic
910636179 1:89410548-89410570 ATGGAGGCTGACTGTGTAGATGG - Intergenic
910752675 1:90650943-90650965 ATGGAGAGTGACTTTGAAGAGGG + Intergenic
913091665 1:115480301-115480323 CTGGAGGCTGCCTGTGAGGAAGG + Intergenic
914681539 1:149942261-149942283 CTCCCGGGTGCATGTGAAGAAGG - Exonic
915721003 1:157985587-157985609 CAGGCTGGTGACAATGAAGATGG + Intergenic
920594014 1:207250529-207250551 ATGGCAGGGGACTGTCAAGAAGG + Intergenic
1063867410 10:10380914-10380936 CTGGCGGGGGACTCTTAAGTTGG - Intergenic
1064068191 10:12201773-12201795 GTGGCAGGTGACTGTGGAAATGG + Intronic
1064713021 10:18145854-18145876 CAGGAGGTAGACTGTGAAGAAGG + Intronic
1066361961 10:34739978-34740000 CTGGCGGGTCAGTGTGTAGGAGG - Intronic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1071613676 10:87055258-87055280 CTGGGGAGTGACTGTAATGATGG + Intronic
1073490700 10:103851346-103851368 CAGGCGGGTCACTGTGAGGCAGG - Intronic
1076331677 10:129675060-129675082 CTCACGAGTGCCTGTGAAGAAGG + Intronic
1076681170 10:132172165-132172187 CTGGCGGGTTATTTTGTAGAAGG + Intronic
1078149899 11:8749547-8749569 CTGGGGAGTGACTGTCATGAAGG - Intronic
1079093195 11:17494822-17494844 CTGGCAGGTGGCTGTGAAACTGG - Intronic
1080639982 11:34152901-34152923 CTGGCATGTGACTGTGCACATGG + Intronic
1080866324 11:36198627-36198649 CTGTCAGGTGAGAGTGAAGAAGG - Intronic
1081731330 11:45373792-45373814 CTGGCCTGTGACTGTGAGGGAGG + Intergenic
1083397259 11:62400416-62400438 CTGGCTGGTGACCATGAGGAGGG - Intergenic
1084154841 11:67307731-67307753 CTGGCGGGTCAGTGTGTGGAGGG + Exonic
1084219299 11:67667677-67667699 CTGGAGGGTGCCCGTGAAGGAGG - Intronic
1084318363 11:68358921-68358943 GTGGCAGGTGTCTGTGCAGAGGG + Intronic
1085460414 11:76689918-76689940 CTGGCGTGTCCCTGTGAAAAGGG + Intergenic
1088195251 11:107266780-107266802 TTGGCTGGTGACACTGAAGATGG + Intergenic
1088826302 11:113497045-113497067 CTGGCCAGTGACAGTGAGGAGGG - Intergenic
1089274925 11:117328202-117328224 CTGGCGGGTGAGTGAGCAGCGGG + Intronic
1089540120 11:119184880-119184902 CTGGGGGGTAAGTGTGAAAAGGG - Intergenic
1091290371 11:134436114-134436136 CTGGGGAGTGACTGTGGTGAGGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094715999 12:33015968-33015990 CTGGAGAGTGACTGTGATGAAGG + Intergenic
1094744514 12:33329493-33329515 CTTGCAGGTGACTAGGAAGAAGG + Intergenic
1096408494 12:51360705-51360727 CTTCCGGGTGAGAGTGAAGAGGG - Exonic
1102785937 12:115604853-115604875 TGGGTGGGTGACTGTGATGATGG + Intergenic
1103219850 12:119234889-119234911 CTTGTGGGTGACTGTGAGCAAGG - Intergenic
1104544914 12:129701894-129701916 CTGGCGGATGACTGCCAAGAAGG - Intronic
1104567986 12:129902731-129902753 CTGGGGGGCGGCTCTGAAGAAGG - Intronic
1104834503 12:131779284-131779306 CGGGTGGGTGTGTGTGAAGAGGG + Intronic
1112302273 13:98240972-98240994 CTGGTGGGTGACTCAGGAGAAGG + Intronic
1113452998 13:110425546-110425568 CTCGTGGGTCCCTGTGAAGAAGG - Intronic
1113822282 13:113223068-113223090 GTGGCTGGTTACTGTGATGAAGG + Intronic
1114560819 14:23589192-23589214 CTGGTGGGAGAGGGTGAAGATGG + Intergenic
1114794078 14:25692656-25692678 CTGGGGAGTAATTGTGAAGATGG + Intergenic
1115319129 14:32059624-32059646 CAGCAGGGTGACTGTGAAGGGGG + Intergenic
1119654561 14:76407920-76407942 CTGGTGGGTGACTGTTGACACGG + Intronic
1120833166 14:89016118-89016140 GTGGAGGGTGACTAGGAAGATGG + Intergenic
1120962719 14:90140030-90140052 CTGTGGGGTGACTGTGCAGATGG + Intronic
1125484885 15:40105025-40105047 CTGGCGGGAGTCTGAGAAGTTGG - Intronic
1127166714 15:56251315-56251337 TTGGAGGGTGACTGTGGATATGG - Intronic
1127306792 15:57713979-57714001 GTGGCGGGTGCCTGTGAACCCGG - Intronic
1128061757 15:64739754-64739776 CTGGCTTGTGACTGTAAAGGTGG - Intergenic
1131197128 15:90364559-90364581 CTGAAGGGTGGCAGTGAAGATGG - Intronic
1134421179 16:14091429-14091451 TTGGTTGGTGACTGTGAAGATGG - Intronic
1134638127 16:15808188-15808210 CTGTGGTGTGACTGTGAAGGTGG + Intronic
1136553787 16:30996449-30996471 TTGGTGGGTGAATGTGAAGATGG + Intronic
1137253779 16:46758854-46758876 CTGACGGTTGTCTGAGAAGATGG + Intronic
1138241549 16:55431396-55431418 CTTGTAGGTGATTGTGAAGATGG - Intronic
1138637929 16:58357877-58357899 CAGGGGGGAGAGTGTGAAGAGGG - Intronic
1139511750 16:67431770-67431792 CTGACTGGTGGCTGAGAAGAGGG + Intronic
1140648391 16:77059967-77059989 TTGGTGGGTGACTGTGTAGATGG + Intergenic
1141510027 16:84505873-84505895 CTGGCTGGTGACAGTGCACAAGG + Intronic
1141533424 16:84662155-84662177 CTGGGAGGTGACGGTGAGGATGG - Exonic
1141717749 16:85736445-85736467 CGGGGAGGTGAATGTGAAGATGG + Intronic
1142120043 16:88382788-88382810 CTGGCTGGGGAGTGTGAAGAGGG + Intergenic
1143631405 17:8142448-8142470 CTGGCTGCTGCCTGTGAAGTGGG + Exonic
1147661480 17:42119325-42119347 CCGGCGGGTAACGGTGAAAATGG + Exonic
1148225658 17:45896421-45896443 CTGGCCGGAGAATGTGAGGAAGG + Intronic
1148744892 17:49912672-49912694 ATGGGGGGTGACTGTCAACAGGG - Intergenic
1149276025 17:55038286-55038308 GTGGCGGCTGACTGGGAAGGTGG - Intronic
1152941571 17:83175526-83175548 CCTGAGGGTGACTGTGAGGAAGG - Intergenic
1153098344 18:1435439-1435461 CTGGCTGGTGGCAGTGAAGTTGG - Intergenic
1153660233 18:7319522-7319544 CTGCTGGGTCACTGTGATGATGG - Intergenic
1154411877 18:14146068-14146090 CTGGAGGGTGACTCAGAAGGTGG - Intergenic
1155384538 18:25262961-25262983 CTGGTGAGTAACTGTGAAGCAGG + Intronic
1155514296 18:26608594-26608616 CTGGGGGGTGACAGTGCAGAGGG - Intronic
1156632250 18:38984274-38984296 CAGGAGGGAGAATGTGAAGAAGG - Intergenic
1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG + Intergenic
1158406959 18:57168323-57168345 CTGCCGGGAAACTCTGAAGAGGG + Intergenic
1161943080 19:7418011-7418033 CTTGCAGGTCACAGTGAAGACGG + Intronic
1162718264 19:12647303-12647325 CAGGCGGGTGATGGTGAAGGTGG + Exonic
1165075773 19:33279121-33279143 CTGGCAGGGGACTGAGAAGCAGG + Intergenic
1167044198 19:47040421-47040443 CTGGGGGGTGACAGAGAAGAGGG - Intronic
1167575248 19:50314806-50314828 CTCGGGGGTGACCGGGAAGAAGG - Intronic
926386141 2:12337668-12337690 GTGGAGGGTAACCGTGAAGATGG + Intergenic
929929365 2:46240083-46240105 CTGGCGGTTGACAGGGGAGAAGG + Intergenic
932498711 2:72161171-72161193 CTGCCGGGTGACTCTCCAGAGGG + Intergenic
934054398 2:88239935-88239957 CGTGGGGGTGGCTGTGAAGAAGG + Intergenic
935418933 2:102846461-102846483 CTGGGGTGTGAGTGTGAAGGCGG + Intergenic
935673069 2:105571977-105571999 CTGGCAGGTGAGTGGGGAGAGGG - Intergenic
936837765 2:116728316-116728338 CTGGCAGGTCACTGTGGATATGG + Intergenic
937121780 2:119445400-119445422 CTGACGGGTTACTGGGTAGAGGG + Intronic
937858340 2:126688979-126689001 CTGGGAGATGATTGTGAAGAAGG - Intronic
937858845 2:126692589-126692611 CTGGGAGATGATTGTGAAGAAGG - Intronic
941542377 2:166802838-166802860 CTGGCCTGTAAATGTGAAGAGGG + Intergenic
944505767 2:200408988-200409010 CTGTTGGGTGACAGTCAAGATGG - Intronic
948012636 2:234662134-234662156 CTGGGTTGTGCCTGTGAAGAGGG - Intergenic
948257456 2:236578423-236578445 CTAGTGGGTGACTCTGAGGACGG + Intronic
948712499 2:239833744-239833766 CGTGTGGGTGCCTGTGAAGAAGG + Intergenic
1172391306 20:34567209-34567231 CTGGCGGCCGACTGTGGAGCTGG + Intronic
1172413069 20:34740881-34740903 ATTGTGGTTGACTGTGAAGAGGG + Exonic
1175654157 20:60754053-60754075 CTGCCAGGTTTCTGTGAAGATGG + Intergenic
1176861155 21:14012264-14012286 CTGGAGGGTGACTCAGAAGGTGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1180200659 21:46222178-46222200 CAGGCGGGTCACGGTGAGGAAGG - Intronic
1181674179 22:24441258-24441280 CTGGCGGGTGGCCGTTGAGACGG - Exonic
1181884028 22:26004812-26004834 CTGGTGGCTGACTGTCGAGAAGG - Exonic
1182252104 22:29009075-29009097 CTGCAGGGCCACTGTGAAGAGGG + Intronic
1183700637 22:39449093-39449115 GTTGGGGGTGGCTGTGAAGAAGG - Intergenic
1184076971 22:42187044-42187066 CTGGCAGGTGACTCTGATGCAGG - Intronic
1184717556 22:46290568-46290590 CTGGAGGGTGAGTGTTAGGAGGG + Intronic
1184717564 22:46290599-46290621 CTGGAGGGTGAGTGTTAGGAGGG + Intronic
1184717578 22:46290656-46290678 CTGGAGGGTGAGTGTTAGGAGGG + Intronic
952039697 3:29247284-29247306 CTGCTGGGTGACTGTGATGGTGG - Intergenic
952979739 3:38725084-38725106 CTGGAGGGTGGCGGTGAAGGTGG - Intronic
953713512 3:45295522-45295544 GTGATGGGTTACTGTGAAGAAGG + Intergenic
958193572 3:90213861-90213883 CTGCCTGGTTACTGTGGAGAAGG - Intergenic
958482499 3:94660976-94660998 CTGGTTGCTGACTTTGAAGATGG + Intergenic
964059843 3:152507941-152507963 CTTGAAGGTGACTTTGAAGAGGG - Intergenic
967774628 3:193373949-193373971 TTGGTGGGTGTCTGTGCAGAAGG + Intronic
968460063 4:720351-720373 GTGGAGGGTGACTGTGCAGGAGG + Intronic
968702273 4:2062725-2062747 CAGGCTGGTGGCTGTGCAGAGGG + Intronic
969342045 4:6548375-6548397 CCGGCTGGTGGCTGTGAGGATGG - Intronic
969342373 4:6550235-6550257 CCGGCTGGTGGCTGTGAGGAGGG - Intronic
973843034 4:54881807-54881829 TTGGGTGGTGACAGTGAAGACGG - Intergenic
975626249 4:76351009-76351031 CTGGCTGTAGACTGCGAAGATGG + Exonic
976515174 4:85956467-85956489 GTGGCGGGCCACTTTGAAGATGG + Intronic
983111839 4:163760169-163760191 CTGGCTGCTGGCTGTGAAGATGG - Intronic
984237675 4:177180487-177180509 CTGGGTGGTGACTGTTGAGAAGG + Intergenic
985707010 5:1407291-1407313 ATGCCGGGTGGGTGTGAAGAGGG - Intronic
987290175 5:16501354-16501376 CTGCTGGGTGACTGTGAGCATGG - Intronic
990676453 5:58191685-58191707 CTGGTGGGTGAGGGTGGAGAGGG - Intergenic
991391016 5:66143976-66143998 CTGGTGCGGGACTGTAAAGAAGG - Intronic
994093437 5:95827958-95827980 CTGGAGGGTGACTGGGGAAAGGG + Intergenic
1000062742 5:157671355-157671377 CCGGCGCGTTGCTGTGAAGACGG - Intronic
1001527656 5:172440288-172440310 CAGGCGGGTGATTGTGTAGGAGG - Intronic
1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG + Exonic
1002617364 5:180464200-180464222 CAGGAGGGGGACTGGGAAGATGG - Intergenic
1003065359 6:2900366-2900388 CTGGAGTGTGAGTGTGAAGCTGG + Intronic
1006452217 6:34111822-34111844 CAGGCTGGTGACTGAGGAGAGGG - Intronic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1007849271 6:44788400-44788422 TTGGCGGGAGCCTGAGAAGATGG - Intergenic
1009197189 6:60701254-60701276 CTGGTGGCTGGCTGCGAAGAGGG + Intergenic
1010964440 6:82187639-82187661 CAGGTGGGTGACAGTAAAGAGGG + Intronic
1016438515 6:144061541-144061563 CTGGCTGGTGACCTTGAACAAGG - Intronic
1018737657 6:166700366-166700388 CTGGCTGGTGACAGTAAAGCTGG - Intronic
1019165975 6:170097811-170097833 CCTGAGGGTGACTGTGGAGAGGG - Intergenic
1019168912 6:170117670-170117692 CTGGTGTGTGACTGAGGAGAGGG - Intergenic
1019168944 6:170117766-170117788 CTGGTGTGTGACTGAGGAGAGGG - Intergenic
1019184096 6:170210885-170210907 CAGGCTGGTGAAGGTGAAGATGG + Intergenic
1019466984 7:1195334-1195356 CTGCAGGGTCACTGAGAAGACGG - Intergenic
1020406654 7:7842946-7842968 CTGTCCTGTGACTGTGAAGGGGG + Intronic
1020902176 7:14018348-14018370 CTGGTAGGTGACTGTTAAAATGG + Intergenic
1021261410 7:18462192-18462214 CTGGCGGGTGACTGTGAAGATGG - Intronic
1021700186 7:23311624-23311646 CTGGCTGGTGACAGTAAAGCTGG - Exonic
1022506445 7:30911026-30911048 CTGGCGGGTCACTGGGAAGGTGG - Intergenic
1023858990 7:44205845-44205867 CTGGTGGGTGACTGGGAGTAGGG - Intronic
1027429714 7:78098079-78098101 CTGGCTGGTGAGTGCAAAGATGG - Intronic
1029118134 7:98248466-98248488 CGGCCGGGTGACTGTGACGATGG + Intronic
1029441003 7:100586534-100586556 CAGGCGAGTGACTGTCAAGAAGG + Intronic
1031453686 7:121953818-121953840 ATGGTGGGTGGCTGGGAAGAAGG - Intronic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1033588494 7:142791824-142791846 CTGGTGGGTGAATGGGAAGGAGG + Intergenic
1033589996 7:142801171-142801193 CTGGTGGGTGAATGGGAAGGAGG + Intergenic
1034686370 7:152974777-152974799 TTGGCAGGAGACTGTGAAAAAGG - Intergenic
1035472202 7:159117648-159117670 GGGGCAGGTGACTCTGAAGATGG - Intronic
1039518471 8:38152166-38152188 CTGGCGGGAAAGTGTGAGGAAGG - Intergenic
1041419254 8:57648058-57648080 CTGTTGCTTGACTGTGAAGAAGG + Intergenic
1042518181 8:69681774-69681796 CTGACTGGAGTCTGTGAAGATGG - Intronic
1043656568 8:82674596-82674618 CTGGAGTGTGTCTGTGCAGATGG + Intergenic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1053508747 9:38669124-38669146 CGGGCAGGTGTTTGTGAAGAGGG + Intergenic
1054815448 9:69470438-69470460 CTGGGGGATGAATATGAAGACGG + Intronic
1057162336 9:92897148-92897170 TTGGGGGGTGAGTGTGAAGCTGG - Intergenic
1061845592 9:133386431-133386453 GTGTCGGGTGGCTGTGGAGACGG - Intronic
1192447644 X:71222944-71222966 CAGGCAGGTGGATGTGAAGAGGG - Intronic
1192980272 X:76332031-76332053 GGGGCTGGTGACTGTCAAGATGG + Intergenic
1194976405 X:100401257-100401279 CTGGTGGGTGGCTGGGAGGAAGG - Intronic