ID: 1021262243

View in Genome Browser
Species Human (GRCh38)
Location 7:18472527-18472549
Sequence CTGTATCACAAAAAGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021262243 Original CRISPR CTGTATCACAAAAAGCAGTG GGG (reversed) Intronic
904086466 1:27912952-27912974 CTGTCTCAAAAAAAGAAATGTGG - Intronic
904250917 1:29223694-29223716 CTGAATCACAGAAGGCAGTTTGG - Intronic
904431907 1:30469742-30469764 CAGAAGCACAGAAAGCAGTGGGG + Intergenic
904485328 1:30821106-30821128 CTGTTTCAAAAAAAGAAATGAGG - Intergenic
904949268 1:34223149-34223171 CTGGATCAGGAAAAGCACTGAGG - Intergenic
907178382 1:52547150-52547172 CTGTCTCAAAAAAAAAAGTGGGG + Intronic
907636789 1:56143151-56143173 CTGTCTCAAAAAAAGAATTGTGG - Intergenic
909823877 1:80100589-80100611 CTGAATGACAAAAAGTAGTTTGG - Intergenic
910784612 1:90982563-90982585 ATTTCTCAAAAAAAGCAGTGAGG - Intronic
917911690 1:179654453-179654475 TTGTAATACTAAAAGCAGTGGGG - Intronic
918590867 1:186239543-186239565 CTGTTTCACTAAAAGAATTGTGG - Intergenic
919636755 1:200010881-200010903 CTGTCTCAAAAAAAGAATTGAGG - Intergenic
921536469 1:216354685-216354707 CTGAAACACAAAAAAGAGTGGGG + Intronic
1068107274 10:52634331-52634353 CTGTCTCAAAAAAAAAAGTGGGG + Intergenic
1068419199 10:56767315-56767337 CTGTATCATGTAAAGTAGTGAGG + Intergenic
1068419557 10:56772274-56772296 CTGTATTACAAAAAGTACTAAGG + Intergenic
1068473606 10:57496521-57496543 CTGGATTAAAAAAAGCAATGGGG - Intergenic
1073286256 10:102390863-102390885 CTGTCTCAAAAAAAGAAGAGTGG - Intergenic
1074382690 10:112993150-112993172 CTGATTCACAAAATGGAGTGGGG - Intronic
1076228900 10:128803730-128803752 CTGCATGACAAAGAACAGTGGGG - Intergenic
1081212936 11:40358275-40358297 CTGTCTCAAAAAAAGGAGTTTGG - Intronic
1081904120 11:46655740-46655762 CTGTCTCAAAAAAAGAAATGAGG - Intronic
1086256661 11:84885065-84885087 CTGTATGATAAGAAGAAGTGAGG - Intronic
1088610443 11:111571368-111571390 ATGTGTCACATAAAGAAGTGAGG - Intergenic
1090164699 11:124534829-124534851 TTTTATCACTAAAAGCAGAGAGG + Intergenic
1092868467 12:12785005-12785027 ATGCATCAGAAAAATCAGTGGGG - Intronic
1093787783 12:23212808-23212830 TTGTATTACACACAGCAGTGAGG - Intergenic
1095615515 12:44183773-44183795 GTGTATCACATAAAACAGTGAGG + Intronic
1095876648 12:47086263-47086285 TTGAAAAACAAAAAGCAGTGTGG - Intronic
1096571880 12:52528117-52528139 CAGTATCACCAAAAGCAACGAGG - Intergenic
1096755622 12:53797092-53797114 CTGTATCACAAATAGACATGGGG - Intergenic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1104431153 12:128717477-128717499 CTGGGTCACAAAAAGCATTGTGG + Intergenic
1105064913 12:133188199-133188221 CTGTCTCAAAAAAAAAAGTGGGG - Intronic
1107347806 13:39481669-39481691 CTGTAACACAAAAAGGAAGGGGG + Intronic
1108794349 13:54013045-54013067 ATATATTACTAAAAGCAGTGAGG + Intergenic
1108992506 13:56678976-56678998 AAGTATCTCAAAAAACAGTGTGG + Intergenic
1109313122 13:60718652-60718674 CTGTTTCACGAAAAGCACTGAGG - Intergenic
1110568792 13:76982401-76982423 CGGGATCACATAAGGCAGTGAGG - Intergenic
1110636375 13:77771061-77771083 AGCTATGACAAAAAGCAGTGGGG - Intergenic
1112837559 13:103534481-103534503 CTGTATCTCAGAAAGCAGTTAGG + Intergenic
1113045334 13:106148724-106148746 CTGTGTATGAAAAAGCAGTGTGG - Intergenic
1113531064 13:111027863-111027885 CTGTAACACAAAATGCACCGAGG + Intergenic
1114825049 14:26067083-26067105 CTGTCTATCAAAAAGCTGTGTGG - Intergenic
1115150403 14:30277914-30277936 CCCTATGACAAAAAGCAGTCAGG + Intergenic
1116027951 14:39537253-39537275 CTGTGTAAAAAAAAGCAGTCTGG - Intergenic
1118151960 14:63199352-63199374 CTGATTTACAAAAAGCACTGTGG - Intergenic
1118179741 14:63480449-63480471 CTGTCTCAAAAAAAACAGTTGGG + Intronic
1120476633 14:84997227-84997249 CTGTACCACACACAGCACTGTGG + Intergenic
1123886211 15:24730546-24730568 CTGTAGCACAAAGCCCAGTGGGG - Intergenic
1124583789 15:30986797-30986819 CTGTATCGCAGAAAGGCGTGGGG - Intronic
1124677690 15:31699702-31699724 CTGCCTCACAGCAAGCAGTGTGG - Intronic
1125091595 15:35799384-35799406 GTGTATAATAAAAAGAAGTGGGG - Intergenic
1126779457 15:52126316-52126338 CTTTATCAGAAAAAAAAGTGGGG - Intronic
1126796783 15:52266081-52266103 ATGGATCACAGAAAGCAGGGAGG - Intronic
1128079624 15:64848649-64848671 CTGGATCAAGAAGAGCAGTGGGG + Exonic
1128368379 15:67021259-67021281 CTGTATATAAAAAAGCATTGTGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1130690237 15:86075950-86075972 CTGTAACCAAAATAGCAGTGAGG - Intergenic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1131020145 15:89090574-89090596 CTGAATCACAAAAATAAGTAAGG - Intronic
1137968722 16:52962414-52962436 CTGTCTCAAAAAAAAAAGTGGGG - Intergenic
1140741123 16:77942556-77942578 CTGTTTCTCCAAAGGCAGTGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141614233 16:85201489-85201511 CTGTACCACAAAAATTAGTTGGG + Intergenic
1143812518 17:9483786-9483808 GTGTGTCACACAAAGCAGAGAGG + Intronic
1143853449 17:9830830-9830852 GTATAGCACAAAAATCAGTGTGG + Intronic
1147635727 17:41962718-41962740 CTGTGTCACTAGAAACAGTGTGG - Intronic
1147640457 17:41995048-41995070 CTCTATCAAAAGAGGCAGTGTGG - Intronic
1149457888 17:56803140-56803162 CTGTATGACAAAGTGCAATGGGG + Intronic
1150688077 17:67336680-67336702 CTGCATCACAGAAGGCAGTATGG + Intergenic
1151119517 17:71777057-71777079 CTGTATCATCAAAATCAGTCTGG - Intergenic
1151512970 17:74572908-74572930 CTGGGTGACAAGAAGCAGTGAGG + Intergenic
1154113881 18:11593961-11593983 CTGAACCCCAAAAAGCAGAGAGG - Intergenic
1154351849 18:13589912-13589934 CTGAGTCACAAAAGCCAGTGGGG + Intronic
1156377138 18:36524861-36524883 CTGACTCACATAAAGCAATGAGG - Intronic
1157889937 18:51406068-51406090 CAGGATCAGATAAAGCAGTGTGG + Intergenic
1161246516 19:3255486-3255508 CTGGTTCAAAAAAAGCAGTCGGG - Intronic
1161507815 19:4653297-4653319 CTGTCTCAAAAAAAGAAGCGGGG + Exonic
1161937545 19:7381374-7381396 CTTTATCCGAAACAGCAGTGGGG + Intronic
1164312813 19:24060976-24060998 CTATGTCACAAAAATCAATGAGG - Intronic
1164689611 19:30200798-30200820 CTCTATCTCAAAAAGAACTGTGG + Intergenic
1165429278 19:35763204-35763226 CTGTATCAAAAAAAAAAGGGGGG - Intronic
1167192539 19:48001559-48001581 CTGTCTCAAAAAAAGGAGTGTGG - Intronic
1168142360 19:54397054-54397076 CTGTCTCAGAAAAAAAAGTGAGG + Intergenic
928640080 2:33289044-33289066 CTGTATCAGGAAAGGCAGTCAGG - Intronic
929744393 2:44640999-44641021 CTGTAACATAAAAAGGAGGGAGG - Intronic
932007462 2:67940903-67940925 CTAGGTCACAAAAGGCAGTGTGG + Intergenic
932695247 2:73950841-73950863 CTGCAGCACAGAGAGCAGTGGGG + Intronic
933000418 2:76915252-76915274 ATGTATCACAAAAATCATTCTGG + Intronic
934038773 2:88110492-88110514 CTGTTCCACAAGAAGCAATGAGG + Exonic
938132374 2:128727654-128727676 CTCTGTCACAAAAAGATGTGGGG + Intergenic
941842456 2:170101028-170101050 CTGAATAACAAAAAACACTGCGG - Intergenic
942741753 2:179188637-179188659 CTGTCTCAAAAAAAGGGGTGGGG + Intronic
942825286 2:180168392-180168414 CTGTGCCACAAAAAGTAGTGCGG - Intergenic
943092512 2:183391091-183391113 GTGTACCATAAAAAGAAGTGAGG - Intergenic
946457068 2:219835753-219835775 CTGTTTCAAAAAAAAAAGTGAGG + Intergenic
946864985 2:224034743-224034765 CTATATCCCAAACAGCAGTGGGG - Intronic
948161212 2:235826448-235826470 TTGTCTCAAAAAAAGGAGTGGGG - Intronic
1169165195 20:3416689-3416711 CTGTATCACTATAAGCATTTTGG + Intergenic
1169743579 20:8920443-8920465 CTGAAGCTCAAAAACCAGTGAGG - Intronic
1175312601 20:58022027-58022049 CAATATCACAAAATGTAGTGGGG + Intergenic
1178030010 21:28514290-28514312 TTGTAACACAAAAAGCAGATGGG + Intergenic
1179574446 21:42298977-42298999 CCTTAACACAAAAAGCAGTGGGG - Intergenic
1180119271 21:45735950-45735972 CTGTCTCACACAATGCACTGTGG + Intronic
1183646103 22:39127698-39127720 CTGTCTCAAAAAAAACAGGGTGG + Intronic
950024614 3:9811588-9811610 CTGTATTACAAAAAGATGAGGGG - Intronic
950283460 3:11726234-11726256 TTGTTCCACAAAAAGCACTGAGG + Intergenic
953712975 3:45290657-45290679 CTGGAACACAGAAAGGAGTGTGG + Intergenic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
957888152 3:86317658-86317680 CTATAAAACAAAAATCAGTGTGG - Intergenic
958726639 3:97913625-97913647 CTGTTTGAAAACAAGCAGTGGGG + Intronic
958887402 3:99741767-99741789 CAGGATCACAAAAGGCCGTGAGG - Intronic
960247155 3:115412457-115412479 CTGGATCATAGAGAGCAGTGAGG - Intergenic
964653772 3:159043551-159043573 CTGTCTCAAAAAAAGCGGGGCGG - Intronic
966955220 3:184869881-184869903 CTGTATCTAAAAAAACAGTCAGG + Intronic
968324017 3:197796399-197796421 CTGCATAACAGAAAGCTGTGAGG + Intronic
968745681 4:2358804-2358826 CTGTCTCAAAAAAAAAAGTGGGG - Intronic
971454304 4:26829781-26829803 ATGTATCACAAAAAGCTGCCAGG - Intergenic
972509768 4:39757588-39757610 CTTTCTAACATAAAGCAGTGTGG + Intronic
975873719 4:78810895-78810917 CTTTATTAAAAAAAGCAATGAGG - Intronic
976930275 4:90559090-90559112 CTGTAGCTCACAAAGCAGTGTGG - Intronic
978957783 4:114635541-114635563 CTCTATCACAAAAAGCTGAAAGG - Intronic
981070979 4:140538349-140538371 CTTTATAACAAAAAGTACTGTGG + Intronic
984489459 4:180414583-180414605 CTGGATCACAAAAAGACATGTGG - Intergenic
986191350 5:5498880-5498902 CAGAATAACAAAATGCAGTGCGG - Intergenic
986834054 5:11614808-11614830 CTGTAGCACCAATATCAGTGTGG + Intronic
988128777 5:27076699-27076721 CTATTTCACAAAAAGGAGTTGGG + Intronic
988681145 5:33485351-33485373 TTGTCTCATCAAAAGCAGTGTGG + Intergenic
992728182 5:79630568-79630590 CTCTGTCTCAAAAAGTAGTGGGG + Intronic
994083634 5:95734715-95734737 ATATTCCACAAAAAGCAGTGAGG + Intronic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
995047508 5:107669410-107669432 CTGTCCCAGAGAAAGCAGTGCGG + Intronic
995190922 5:109318585-109318607 CTGTCTCAAAAAAAAAAGTGGGG - Intergenic
996430044 5:123364530-123364552 CTGCATTACAAGCAGCAGTGGGG - Exonic
1001010151 5:168090163-168090185 CTGTATTACATAATGCAGAGGGG + Intronic
1001289461 5:170446465-170446487 CTGTATCTAAAAAAGAAGTAGGG - Intronic
1002684264 5:180995610-180995632 CTCTCTCACAAGAAACAGTGAGG - Intronic
1004534318 6:16485197-16485219 CTGTGTCACAAAACACAGTTAGG - Intronic
1007097893 6:39225527-39225549 CTGTCCCACCAAAAACAGTGGGG - Intronic
1008972262 6:57383304-57383326 CTATTTCACACAAAGAAGTGTGG - Intronic
1009161177 6:60284841-60284863 CTATTTCACACAAAGAAGTGTGG - Intergenic
1010083904 6:71893356-71893378 TTTTAGCACAAAAAGCAATGTGG + Intronic
1010236967 6:73583099-73583121 CTCTGTCACAATAAACAGTGTGG + Intergenic
1010278218 6:73993307-73993329 CTGGAGCACAACAATCAGTGGGG - Intergenic
1012696424 6:102390529-102390551 TTGTATCACAAAATTCAGTTGGG - Intergenic
1012864324 6:104599420-104599442 CTGTTTCAAGAAAGGCAGTGAGG + Intergenic
1016508456 6:144812404-144812426 ATGTATCACAAGAAGCAGCAAGG - Intronic
1017345010 6:153370089-153370111 CTGTCTAATAACAAGCAGTGAGG - Intergenic
1018362155 6:163081749-163081771 CTGTCTCAGAAAAAAAAGTGGGG + Intronic
1019618211 7:1976512-1976534 CTACATCTCATAAAGCAGTGCGG + Intronic
1021262243 7:18472527-18472549 CTGTATCACAAAAAGCAGTGGGG - Intronic
1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG + Intergenic
1023457320 7:40354465-40354487 CTGTATCTCAAGAAGCAGCCAGG - Intronic
1024839173 7:53564585-53564607 GTGTATAAGAAATAGCAGTGAGG + Intergenic
1026123479 7:67558622-67558644 CTGTAGCACCAAAAACAGGGGGG - Intergenic
1026354259 7:69543704-69543726 CTGTATCACTACAAGGAATGGGG - Intergenic
1026501397 7:70946203-70946225 CTGTCTCACCTAAAGCAGTCAGG + Intergenic
1030188492 7:106787720-106787742 CTGCGTCTCAAAATGCAGTGTGG - Intergenic
1031233076 7:119135037-119135059 ATGTAACACAAAGTGCAGTGAGG + Intergenic
1032684093 7:134213167-134213189 GTGTAGCACAAAAAGCACTTTGG - Intronic
1032809841 7:135401598-135401620 TTGTACAGCAAAAAGCAGTGGGG + Intronic
1034039383 7:147861085-147861107 CCTTATCACAAACAGAAGTGTGG - Intronic
1034674773 7:152884502-152884524 CTCTGTCACAGGAAGCAGTGAGG - Intergenic
1037346044 8:17902306-17902328 CTGTCTCAAAAAAAAGAGTGAGG + Intronic
1041705811 8:60845072-60845094 CTGTAGCACAAACAGCATGGTGG - Intronic
1041989505 8:63968708-63968730 CTGCCTCACACAGAGCAGTGAGG + Intergenic
1043590193 8:81822464-81822486 CTGCATCACAAAGATCACTGTGG + Intronic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1046038871 8:108878133-108878155 CTGTATGTCAAAAAGCAAAGGGG - Intergenic
1046778839 8:118193611-118193633 TTGTTGCCCAAAAAGCAGTGAGG - Intronic
1047234235 8:123025357-123025379 CTGTATCCCAAAGACCAGTGAGG + Intronic
1048897345 8:139004206-139004228 TTGAGTCACAAAGAGCAGTGTGG - Intergenic
1056494001 9:87137808-87137830 ATTAATCACAGAAAGCAGTGTGG - Intergenic
1056724684 9:89104357-89104379 CTGAATCACAAAACTCTGTGGGG + Intronic
1060035507 9:120252121-120252143 CTGTATTACACAGAGCACTGTGG - Intergenic
1190898318 X:54642716-54642738 TTATATGACAGAAAGCAGTGGGG - Intergenic
1191243683 X:58209114-58209136 CTCTATCATAAAAATGAGTGGGG - Intergenic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1195032340 X:100938275-100938297 CTCTCTCACAAACAGCAGTGTGG + Intergenic
1199309734 X:146308663-146308685 CTGTATGACAAATAGCAGTGTGG + Intergenic
1199533038 X:148871102-148871124 CTGCATGAGAAAAAGCAGTGTGG + Intronic
1201530408 Y:14985049-14985071 CTAGATCACAAAAAGGACTGAGG - Intergenic