ID: 1021262857

View in Genome Browser
Species Human (GRCh38)
Location 7:18480472-18480494
Sequence CTGGCACAGCAGTTGCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021262857_1021262861 -6 Left 1021262857 7:18480472-18480494 CCATAGAGCAACTGCTGTGCCAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1021262861 7:18480489-18480511 TGCCAGAAAGTTTGTAGGGAGGG No data
1021262857_1021262863 1 Left 1021262857 7:18480472-18480494 CCATAGAGCAACTGCTGTGCCAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1021262863 7:18480496-18480518 AAGTTTGTAGGGAGGGAGAGTGG 0: 1
1: 0
2: 1
3: 62
4: 933
1021262857_1021262860 -7 Left 1021262857 7:18480472-18480494 CCATAGAGCAACTGCTGTGCCAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1021262860 7:18480488-18480510 GTGCCAGAAAGTTTGTAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 149
1021262857_1021262864 6 Left 1021262857 7:18480472-18480494 CCATAGAGCAACTGCTGTGCCAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1021262864 7:18480501-18480523 TGTAGGGAGGGAGAGTGGTTAGG No data
1021262857_1021262859 -10 Left 1021262857 7:18480472-18480494 CCATAGAGCAACTGCTGTGCCAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1021262859 7:18480485-18480507 GCTGTGCCAGAAAGTTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021262857 Original CRISPR CTGGCACAGCAGTTGCTCTA TGG (reversed) Intronic
900420494 1:2554039-2554061 CTGGCACAGCATTGGGTCTGGGG + Intergenic
901199614 1:7459220-7459242 CAGGCTCAGCAGTTTGTCTAAGG - Intronic
902030840 1:13421008-13421030 GTGGCACAGCAGGTTCTCCAGGG - Exonic
905076174 1:35272537-35272559 CTAGTACAGCAGAGGCTCTATGG + Intronic
905948278 1:41922124-41922146 CTAGCACAGCATTTGATCTAAGG - Intronic
906053931 1:42899778-42899800 CTGCCACAGCAGATGCTCTCTGG - Intergenic
907762592 1:57376160-57376182 CTGGCAGAGCAGTTGATTTTGGG - Intronic
908420128 1:63951516-63951538 CTGGCACAGCAGGTGCCATCAGG + Intronic
909840243 1:80311789-80311811 TTCCCACAGCAGTTGGTCTAGGG + Intergenic
910119561 1:83771373-83771395 CTGGCACATCACTTGATCCAGGG + Intergenic
911525096 1:98974853-98974875 TTTGCACCTCAGTTGCTCTAAGG + Intronic
912369427 1:109162100-109162122 CTGGCAGAGCAGCTGCATTAAGG + Intronic
914675801 1:149906473-149906495 CTGGCACAGAAGCTTCTCTGGGG - Intronic
914690893 1:150025803-150025825 CTGCCACAATAATTGCTCTAGGG - Intergenic
914827665 1:151146934-151146956 CTGGCACAGGAGAGGCTCTGGGG + Intergenic
916191653 1:162184986-162185008 CTGGCACAGCTGTTTCTTTCTGG + Intronic
916447525 1:164887420-164887442 CTGGCACAGCAGTTGCAATTGGG - Intronic
919277935 1:195445147-195445169 CTGCCACAGCTGATGCTCTCTGG + Intergenic
919538714 1:198821591-198821613 CTGGTACAGTAGTAGCTCAAGGG + Intergenic
920195774 1:204226155-204226177 CTGGCAGAGCTGTAGCTCTGGGG + Intronic
920579862 1:207096403-207096425 CTGGCGCAGGTGTTGCTCTGAGG + Intronic
1067528840 10:47055770-47055792 CAGGCACAGCACTTCCTCTTTGG + Intergenic
1072619596 10:97070968-97070990 CTGGGACTACAGATGCTCTACGG + Intronic
1073094804 10:100972948-100972970 CTGGGACTGCAGTTGCTGTGAGG - Exonic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076207391 10:128614076-128614098 GTGGCACATCAGTTACTCTGGGG - Intergenic
1076666270 10:132094733-132094755 CTCCCACAGCAGATGCTCTCTGG - Intergenic
1076696226 10:132248670-132248692 CTGGCACAGCAGGTGCCATGTGG - Intronic
1077772232 11:5232610-5232632 CTGGCACTGCAGAGGTTCTAGGG - Intergenic
1078060127 11:8037945-8037967 CTAGCTCAGAAGTGGCTCTAGGG + Intronic
1079371269 11:19854946-19854968 CTGGCAAAGCACTTGCTGTTTGG + Intronic
1089759668 11:120713972-120713994 CTGGAGAAGCAGGTGCTCTATGG - Intronic
1089921801 11:122215939-122215961 CTGGCTCATCAGCTGCCCTAAGG - Intergenic
1091750793 12:3020280-3020302 CTGGAACAGAAGTTGCTTGAGGG + Intronic
1093314746 12:17634359-17634381 CTGGCCAGGCAGTTGCTCTGTGG + Intergenic
1097818270 12:64099299-64099321 CTGGCACAGAATATGCTCAATGG + Intronic
1098268832 12:68750615-68750637 CTGGAACAGCAGGGGCTCTCAGG - Intronic
1098716655 12:73835060-73835082 CAAGAACATCAGTTGCTCTACGG + Intergenic
1101575177 12:105990678-105990700 CTAGCACAGCATTTGGTCCATGG + Intergenic
1102534475 12:113570224-113570246 CTGTCACAACATTTGCTCTAGGG - Intergenic
1102534809 12:113573531-113573553 CTGTCACAACATTGGCTCTAGGG - Intergenic
1103870124 12:124085423-124085445 CTGGAACAGCCGTGGCACTAGGG - Intronic
1104727616 12:131087680-131087702 CTGGCGGGGCAGCTGCTCTAGGG - Intronic
1105824777 13:24112338-24112360 GTGGCACAGAAGGTGCTGTAGGG - Intronic
1111913000 13:94332554-94332576 CTGGCTCAGCCGTTGGTCTCTGG + Intronic
1112138894 13:96615868-96615890 CTGGGAAAGCAGTTGCTCCATGG + Intronic
1113223562 13:108133647-108133669 GTGTCACAGCAGTAACTCTAGGG + Intergenic
1121338807 14:93092978-93093000 CTGGGACAGAGGTTCCTCTAGGG - Intronic
1121535166 14:94686157-94686179 CTGGGACAGCAGTGCCTCCAGGG + Intergenic
1127796006 15:62438860-62438882 CTAGCACAGCTGTTGCTAGAAGG - Intronic
1128403716 15:67313518-67313540 CTTGCCCATCAGTTCCTCTAAGG - Intronic
1130353981 15:83113523-83113545 CTGGCACAGGAAGTGCTCAAAGG - Intronic
1131340800 15:91598899-91598921 CTGGTCCAGCAGTTGCCCTCTGG - Intergenic
1131941996 15:97577020-97577042 CTGGGCAAGCTGTTGCTCTATGG - Intergenic
1132202875 15:99967211-99967233 CTGGCACAGCAGTTTGTGTGGGG - Intergenic
1133054608 16:3139298-3139320 CCAGCCCTGCAGTTGCTCTAAGG + Intronic
1137671559 16:50282324-50282346 CTGGCCCTGCAGTTGCAGTATGG + Intronic
1138133973 16:54505416-54505438 CTGGCACATCAGTTCTTCCATGG + Intergenic
1139367988 16:66445564-66445586 CTGGAACAGAAGTTGCTAGAGGG + Intronic
1140271592 16:73471207-73471229 CTGGTACAGCTTTTGCTCTTGGG + Intergenic
1140829280 16:78736387-78736409 ATGGCACAGCAGCTGCTAAAAGG + Intronic
1141474571 16:84264110-84264132 TTGGCACAGAAGTTGCTGTGTGG + Intergenic
1146285883 17:31573963-31573985 CTGGCACTGCACCTGCTCTTTGG - Intronic
1147820386 17:43238063-43238085 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147822498 17:43249954-43249976 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147823431 17:43255408-43255430 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147825014 17:43264749-43264771 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147828135 17:43282270-43282292 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147829245 17:43288434-43288456 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1147830336 17:43294570-43294592 CAGCCACAGCTGTTGCTCGAAGG + Intergenic
1150327751 17:64270219-64270241 CTGCCACAGCAGTGGCTGGAAGG + Intergenic
1150945641 17:69743027-69743049 CTGCCACAGCTGATGCTCTCTGG - Intergenic
1151383357 17:73740571-73740593 CTGGCCCAGCCATTGCTCTTGGG - Intergenic
1156850167 18:41716848-41716870 CTGGCAAAGCAGTGACTCCAGGG + Intergenic
1164812996 19:31172891-31172913 CTGGCACAGCAGTAGGTCAGTGG + Intergenic
1167553663 19:50178882-50178904 CTGGCACAGCAGCTGCACAGCGG + Intergenic
1167767464 19:51493016-51493038 CCTGCACAGCAGATGCTCCATGG + Intronic
1168458371 19:56533615-56533637 CTGCCACAGCTGGTGCTCTTTGG - Intergenic
925066670 2:933157-933179 CTGGGTCAGCACTTTCTCTAGGG - Intergenic
926967695 2:18433227-18433249 CTGGAACAGCAGATCCTCTAAGG - Intergenic
927467336 2:23347333-23347355 CGGGAACAGCATTTGCTCCACGG + Intergenic
929052813 2:37852570-37852592 CTGTCACAGAAGTGGCTTTATGG - Intergenic
929245522 2:39697887-39697909 CTAGCACAGAAGCTGTTCTAAGG + Intronic
931994021 2:67822837-67822859 CTGGCACAGTACTTGCTACATGG + Intergenic
936891718 2:117378472-117378494 CTGGAACAGCAGTTTCTCCAGGG - Intergenic
938036389 2:128038422-128038444 CTGGGACAGCAGCTGCTTGAGGG - Intergenic
938607632 2:132912182-132912204 CAGGCACAGCAGTCCCTGTATGG - Intronic
938764113 2:134449118-134449140 CTGTCACTGCAGCTGCTCCAGGG + Exonic
939743549 2:145940124-145940146 CTGACACAGCAGATGCTATTTGG - Intergenic
942951683 2:181728882-181728904 CTGTCACTGCAGTTGGTCTCAGG + Intergenic
945985773 2:216352359-216352381 CTGCCCCAGCAGATGCTCCAGGG + Intronic
946276782 2:218637600-218637622 CTGGCTCAGCAGCTACACTAAGG - Intergenic
1168925545 20:1576017-1576039 CTGGCACAGTTGCTGCTCTCTGG + Intronic
1168929423 20:1609045-1609067 CTGGCACAGTTGCTGCTCTCTGG + Intronic
1169207857 20:3750002-3750024 GCGGCACAGCAGCTGCTCGAAGG - Exonic
1170150578 20:13222022-13222044 CTGCCAAAACAGTTGCTCTTAGG - Intronic
1176033515 20:63025239-63025261 CTGGCTGAGCAGTTTCTCTGTGG + Intergenic
1177883364 21:26719891-26719913 CTGGCAAGGCAGCGGCTCTATGG - Intergenic
1178699742 21:34823004-34823026 CTGGCACAGCATAAGCTCTCTGG + Intronic
1180116915 21:45713701-45713723 CTGGAATGGCAGGTGCTCTAAGG - Intronic
1181305483 22:21914723-21914745 CATGCACAGGAGTTTCTCTAGGG - Intergenic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1183760846 22:39815636-39815658 CAGGGACAGGAGTTTCTCTAGGG - Intronic
949501592 3:4685220-4685242 CATGCACAGCAGCTGCTCTCAGG + Intronic
951967161 3:28399424-28399446 CTGCCACAGCTGATGCTCTCTGG + Intronic
953950578 3:47186550-47186572 CTGGCACAGCAGCTGCATTTGGG + Intergenic
954785492 3:53089530-53089552 GAGGCACAGCTGTGGCTCTAGGG + Exonic
957725434 3:84059322-84059344 CTGCCACATCACATGCTCTAAGG - Intergenic
959810953 3:110618684-110618706 CTGGCATAGAAATTGCTCCAGGG + Intergenic
961601834 3:128068337-128068359 CAGTCACAGCTGTTGCTCTCAGG - Intronic
961821826 3:129579124-129579146 CTGGCAGAGCAGCTGCTTCATGG + Intronic
963077018 3:141356254-141356276 CCTGCACAGCAGTTGGACTAGGG + Intronic
966763448 3:183437202-183437224 CTGGTACAGCAGCTGCAATAGGG - Intergenic
968011617 3:195283651-195283673 ATGGCATAGCAATTGCTCTTCGG - Intronic
968484193 4:850805-850827 GTGGTACAGCAGATGCTCCAGGG + Intronic
968484203 4:850862-850884 AAGGCACAGCAGATGCTCCAGGG + Intronic
968970060 4:3789054-3789076 CTGGCCCAGCAGCTCCTCTAAGG + Intergenic
971353499 4:25873408-25873430 CAGACACAGAAGTCGCTCTAGGG - Intronic
973703243 4:53556759-53556781 CTAACACAGCAGATGCTCTTTGG - Intronic
982003250 4:151040533-151040555 CTGGCACAGTACTTGCAATAAGG - Intergenic
984351159 4:178595603-178595625 ACAGCACAGCTGTTGCTCTATGG - Intergenic
989582070 5:43042491-43042513 CTGTCACAGCACTTGCTGCACGG - Intronic
991126117 5:63071716-63071738 CTTGCACAGAATTTGTTCTACGG - Intergenic
994003552 5:94810447-94810469 CTGGCACTTCAGTTGCTCATGGG + Intronic
997798207 5:136833013-136833035 CTGGAACACCAGTTACTCTTAGG + Intergenic
998369886 5:141654124-141654146 CTGGAGCAGCTGTTCCTCTAGGG + Exonic
998536551 5:142937519-142937541 ATGACACAGCAATTGCTCTGGGG + Intronic
998650773 5:144118971-144118993 CTGGCACAGCAAATGCTCCCTGG + Intergenic
999945595 5:156591893-156591915 CTGAGCCAGCAGTTGCTCTGTGG + Intronic
1001041729 5:168341016-168341038 CTGGCACAGTAGCTGCTATAAGG - Intronic
1001278233 5:170366447-170366469 CAGGCACAGCAGATGCTCAAAGG - Intronic
1003030223 6:2594962-2594984 CTGGCACTGCAGCTGCACTTGGG - Intergenic
1004639007 6:17495994-17496016 CATGCACAGCAGTTGCTTTCAGG - Intronic
1004706206 6:18126138-18126160 CTGGCTGAGCAGTGGCTCAAGGG + Intergenic
1006129735 6:31862153-31862175 CACCCACAGCAGTTGCTCCATGG + Exonic
1010007363 6:71010528-71010550 CTGCCTCAGCTGTAGCTCTAGGG + Intergenic
1010114777 6:72290718-72290740 CTGGCTGATCAGTTGCTCTTGGG - Exonic
1010169472 6:72957993-72958015 AAGGCACAGCACTTGCTCTAAGG - Intronic
1011662820 6:89608964-89608986 AGGGCACAGGAGGTGCTCTAGGG - Intronic
1012212525 6:96539269-96539291 CTTTCATAGCAGTTGCTCTGAGG - Intronic
1015849754 6:137559963-137559985 CTAGCACAGCTGATGCTCTCTGG - Intergenic
1016620302 6:146101586-146101608 CTGGCAGAGCAGTTGCAGTGTGG - Intronic
1016748795 6:147610385-147610407 CTGGCATGGCAATTGCTCTCAGG - Intronic
1018284628 6:162224371-162224393 ATGGTACAGCTGTTGCTCTTAGG - Intronic
1018810071 6:167292874-167292896 CTGGCACAGCAGCTCCCCTGGGG + Intronic
1020220742 7:6234687-6234709 CTGGGAGAGCTGTAGCTCTAGGG + Intronic
1021262857 7:18480472-18480494 CTGGCACAGCAGTTGCTCTATGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1028899445 7:96080427-96080449 CTGGCAAAGAAGTTGCTGTTGGG + Exonic
1030571848 7:111236375-111236397 CTGGCACAGCCTTTAATCTAGGG + Intronic
1030761341 7:113356181-113356203 CTAGTCTAGCAGTTGCTCTAGGG - Intergenic
1031415057 7:121485773-121485795 CTGGCACAGAAGTAGCACCAAGG + Intergenic
1031674607 7:124593995-124594017 CTGGTCAAGCAGTTGCTCTAAGG - Intergenic
1034008671 7:147504236-147504258 CTCCCACAGCAGCTGCTCTCAGG - Intronic
1034823414 7:154237710-154237732 CTGGCCCAGCAGATGCTTCAGGG + Intronic
1035557677 8:578926-578948 CTGGCACAGCCGCTCCTCTCAGG + Intergenic
1035901914 8:3465808-3465830 CTTGCATAGCAGTTTGTCTAGGG + Intronic
1036563603 8:9919166-9919188 CCGCAGCAGCAGTTGCTCTAGGG - Intergenic
1039457560 8:37717607-37717629 CTGGCCCAGCAGGGGCTCTCTGG + Intergenic
1042216621 8:66434692-66434714 TTGTCAGCGCAGTTGCTCTATGG - Intronic
1053137487 9:35660551-35660573 CTGGGCCAGCTGTTGCTCTGGGG - Exonic
1053572544 9:39324595-39324617 CTGGCACAGGGCATGCTCTAAGG + Intergenic
1053891687 9:42699917-42699939 CTGGCACAGGGCATGCTCTAAGG + Intergenic
1054094104 9:60883308-60883330 CTGGCACAGGGCATGCTCTAAGG + Intergenic
1054115573 9:61159223-61159245 CTGGCACAGGGCATGCTCTAAGG + Intergenic
1054124601 9:61294416-61294438 CTGGCACAGGGCATGCTCTAAGG - Intergenic
1054592183 9:67023319-67023341 CTGGCACAGGGCATGCTCTAAGG - Intergenic
1056847708 9:90055143-90055165 CTGGCAGAGCAGTCTTTCTAAGG - Intergenic
1057317683 9:93980163-93980185 CTGGCACAGGAGGTGCCCCAAGG + Intergenic
1060247531 9:121958886-121958908 CTGGAGAAGCAGGTGCTCTAGGG + Intronic
1185986344 X:4838570-4838592 CAGACATAGCAGCTGCTCTAGGG + Intergenic
1190762435 X:53447749-53447771 CTGTCACAGCAGTTTCTCCATGG - Intergenic
1191843492 X:65529496-65529518 CTGGCTCAGCATTTCCTCTGGGG - Intronic
1192766574 X:74146323-74146345 CAGGCCCAACAGTTCCTCTAGGG - Intergenic
1193785975 X:85760333-85760355 CTGCCACAGCTGATGCTCTCTGG - Intergenic
1194701458 X:97119553-97119575 CTACCACAGCTGATGCTCTATGG - Intronic
1199077077 X:143536341-143536363 CTGCCACAGCTGGTGCTCTTTGG + Intergenic
1199668564 X:150121427-150121449 CTAGCACAGCTGATGCTCTCTGG + Intergenic
1199779225 X:151043004-151043026 CTGACTCATCAGTTCCTCTAAGG + Intergenic