ID: 1021262974

View in Genome Browser
Species Human (GRCh38)
Location 7:18481775-18481797
Sequence TAGTGTATACCTTTAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021262972_1021262974 -8 Left 1021262972 7:18481760-18481782 CCCTCACTGTGGATCTAGTGTAT 0: 1
1: 0
2: 3
3: 5
4: 98
Right 1021262974 7:18481775-18481797 TAGTGTATACCTTTAGCATATGG No data
1021262973_1021262974 -9 Left 1021262973 7:18481761-18481783 CCTCACTGTGGATCTAGTGTATA 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1021262974 7:18481775-18481797 TAGTGTATACCTTTAGCATATGG No data
1021262971_1021262974 -7 Left 1021262971 7:18481759-18481781 CCCCTCACTGTGGATCTAGTGTA 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1021262974 7:18481775-18481797 TAGTGTATACCTTTAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021262974 Original CRISPR TAGTGTATACCTTTAGCATA TGG Intronic
No off target data available for this crispr