ID: 1021263321

View in Genome Browser
Species Human (GRCh38)
Location 7:18486379-18486401
Sequence CATAAGGCCCTTCCTTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021263319_1021263321 13 Left 1021263319 7:18486343-18486365 CCAGAATATATCTCTCTGATCTA 0: 1
1: 0
2: 1
3: 37
4: 258
Right 1021263321 7:18486379-18486401 CATAAGGCCCTTCCTTCAAAAGG No data
1021263318_1021263321 22 Left 1021263318 7:18486334-18486356 CCACATTTTCCAGAATATATCTC 0: 1
1: 0
2: 3
3: 46
4: 401
Right 1021263321 7:18486379-18486401 CATAAGGCCCTTCCTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021263321 Original CRISPR CATAAGGCCCTTCCTTCAAA AGG Intronic
No off target data available for this crispr