ID: 1021270336

View in Genome Browser
Species Human (GRCh38)
Location 7:18577133-18577155
Sequence GTTTATTCCCTTACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021270336_1021270338 -7 Left 1021270336 7:18577133-18577155 CCAGATTTTGTAAGGGAATAAAC 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1021270338 7:18577149-18577171 AATAAACTCAGAGGCTGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 284
1021270336_1021270342 25 Left 1021270336 7:18577133-18577155 CCAGATTTTGTAAGGGAATAAAC 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1021270342 7:18577181-18577203 ACTTGTCTCTCTGACAGTGGTGG No data
1021270336_1021270341 22 Left 1021270336 7:18577133-18577155 CCAGATTTTGTAAGGGAATAAAC 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1021270341 7:18577178-18577200 ATAACTTGTCTCTCTGACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 149
1021270336_1021270340 -5 Left 1021270336 7:18577133-18577155 CCAGATTTTGTAAGGGAATAAAC 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1021270340 7:18577151-18577173 TAAACTCAGAGGCTGCTGAGGGG No data
1021270336_1021270339 -6 Left 1021270336 7:18577133-18577155 CCAGATTTTGTAAGGGAATAAAC 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1021270339 7:18577150-18577172 ATAAACTCAGAGGCTGCTGAGGG 0: 1
1: 0
2: 4
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021270336 Original CRISPR GTTTATTCCCTTACAAAATC TGG (reversed) Intronic
902870178 1:19309301-19309323 GTTCACACCCTGACAAAATCTGG - Intronic
906488000 1:46246636-46246658 GTTTCCTCACTTACAAAATGGGG + Intergenic
908949843 1:69547096-69547118 ACTTATTCCCCTAGAAAATCAGG + Intergenic
909794207 1:79712847-79712869 GTTTATTCCCAGACAACATGGGG - Intergenic
909919093 1:81357869-81357891 ATTTATTCATTTACAAAATGAGG + Intronic
910394174 1:86775262-86775284 ATTTCTTCCCTTACAAAGTAGGG + Intergenic
910577330 1:88779441-88779463 GTATATTCCTTTAATAAATCTGG - Intronic
911287196 1:96010221-96010243 TTTTTTCCCCTCACAAAATCTGG - Intergenic
911543964 1:99193378-99193400 GTTTCATCACTTACAAAATATGG - Intergenic
912397448 1:109357579-109357601 ATTTTTTCCCTTACAAACTGGGG + Intronic
913399643 1:118415949-118415971 GATTATACTCTTTCAAAATCTGG - Intergenic
916704347 1:167332876-167332898 ATTTATTCAATTACAAAATGAGG + Intronic
916786424 1:168090353-168090375 GTTTCTTCCTCTACAAAATGGGG - Intronic
918204984 1:182300285-182300307 GCTCATTCCCTTCAAAAATCGGG - Intergenic
920888065 1:209953039-209953061 TTTTGTTCCCTTTCAGAATCTGG + Intronic
921379948 1:214514243-214514265 GTTTATTGCCTTTTAAAATAGGG - Intronic
921430733 1:215062894-215062916 GTTCATTCTCCTATAAAATCAGG - Intronic
922087191 1:222361974-222361996 GATTATTGCCTTCCATAATCAGG - Intergenic
923437461 1:233980931-233980953 GTTTCTTCACTTTCAAAATGAGG - Intronic
923579774 1:235197937-235197959 ATTTACTTCCTTCCAAAATCGGG + Intronic
923845765 1:237729982-237730004 GTTTATTCCTTTATAAAACCAGG - Intronic
924211054 1:241767729-241767751 GATTATTTCCTTTCAAAAACTGG - Intronic
1066471623 10:35703364-35703386 GTATCTTCCCTTTCAAAATAGGG + Intergenic
1067465583 10:46496080-46496102 GTTTAATGGCTTACAAAATCAGG - Intergenic
1067621604 10:47888525-47888547 GTTTAATGGCTTACAAAATCAGG + Intergenic
1068396078 10:56464035-56464057 CTTTCTTCTCTTACAAAATAAGG + Intergenic
1071935791 10:90528804-90528826 ATTTATTATCTTACAAACTCTGG + Intergenic
1074047958 10:109856493-109856515 GTTTCATCCTTTACAAAATGAGG - Intergenic
1074902077 10:117826047-117826069 TTTTATTGCTTCACAAAATCTGG - Intergenic
1075876646 10:125812952-125812974 GGTTCTTCCTTTCCAAAATCTGG + Intronic
1077715758 11:4578659-4578681 ATTTATTCCCTTGGAAAATATGG + Intergenic
1078262659 11:9725276-9725298 TTTTATTCCTATTCAAAATCAGG - Intronic
1078612241 11:12830827-12830849 GTTTTTTCCCTTTAAAAAACTGG - Intronic
1083820614 11:65169326-65169348 GTTTGTTCGCTGACAAAATGAGG + Intergenic
1085779737 11:79397308-79397330 GTTTCTTTACTTACAAAATGGGG - Intronic
1086020154 11:82218072-82218094 GTTTTTTCACTTGCAAAATGGGG - Intergenic
1087248035 11:95862960-95862982 GATTATTTCTTTACAAAGTCTGG - Intronic
1087548967 11:99622373-99622395 GTTGTTTCCATTACAAATTCAGG - Intronic
1090140312 11:124251573-124251595 GTTTAATGACTTAAAAAATCAGG - Intergenic
1093300896 12:17452951-17452973 TTTTATTTCCTTTCAAAAACAGG - Intergenic
1095320824 12:40824047-40824069 TATCATTCCCCTACAAAATCTGG + Intronic
1095456660 12:42392903-42392925 GTTTCTTCATTTACAAAATAGGG - Intronic
1098554503 12:71803461-71803483 GTTTCTTCACTTATAAAATGGGG + Intergenic
1098621523 12:72606541-72606563 GTTTCTTCCTTTATAAAATGGGG - Intronic
1099090133 12:78296086-78296108 GTTGTTCCCCTTATAAAATCTGG - Intergenic
1099530558 12:83774871-83774893 GTTGATTTCCTTACATATTCTGG - Intergenic
1099554454 12:84093012-84093034 ATATATTCCCTTACTAAACCCGG - Intergenic
1099845562 12:88023912-88023934 GTTAAGTCCCTTATAAATTCTGG - Intronic
1100015305 12:90003153-90003175 GTTTCTTCACTTATAAAAACAGG - Intergenic
1100648196 12:96553602-96553624 CTTTATTTCCTTAAAAAATCTGG + Intronic
1101291239 12:103371830-103371852 GTTTTTACCTTTACAAAATGGGG + Intronic
1102800816 12:115732025-115732047 GTTTTCTCCCTTATAAAATTGGG - Intergenic
1104041376 12:125133569-125133591 GTGTATTCCATTCCAAGATCTGG + Intronic
1105249609 13:18686026-18686048 GTTTATTTGCCTTCAAAATCTGG + Intergenic
1107814820 13:44234962-44234984 GTTCGTTCCCTTACAAATTTAGG - Intergenic
1107817708 13:44258951-44258973 TTTTATTTCCTTAAAAAGTCTGG - Intergenic
1108460106 13:50657253-50657275 GTATATTTACTTATAAAATCGGG - Intronic
1108845351 13:54671901-54671923 GGTTATGCCTTTACAAAATTTGG + Intergenic
1109564832 13:64098605-64098627 GTTGAATCCCTTAGAAAATATGG - Intergenic
1110073507 13:71209015-71209037 CTTTCTTCCCTGACAAAATAAGG - Intergenic
1112245066 13:97725820-97725842 GTTTCTTCCCATGCAAAATGAGG - Intergenic
1112468275 13:99664610-99664632 GTTTCTTCACCTACAAAACCAGG - Intronic
1115072953 14:29348199-29348221 GTTTATTGACTTACAAAGTGAGG - Intergenic
1116063340 14:39951567-39951589 GTTTATTCCCTTATGTAACCAGG + Intergenic
1117448240 14:55825604-55825626 TTTTATTCCCTTAAAAAACTTGG + Intergenic
1120187652 14:81411137-81411159 GTATGTTCCCTTTCAACATCAGG + Intronic
1121547196 14:94770873-94770895 GTTTTTGCCTTTACAAAATTTGG - Intergenic
1123950249 15:25264958-25264980 GTTTACTCATTTAAAAAATCTGG + Intergenic
1125017618 15:34951896-34951918 GTTTTCTCCCCTACAAAATAAGG + Intronic
1125085330 15:35723226-35723248 ATTTGTTTCTTTACAAAATCTGG + Intergenic
1126317293 15:47383677-47383699 TTTTATTATCTTACAAAATGGGG - Intronic
1126762580 15:51982894-51982916 GTTTATTTCCTTACTCAATGAGG + Intronic
1126808320 15:52375884-52375906 GCTTATAGCCTAACAAAATCAGG - Intronic
1132301206 15:100776876-100776898 GTTTCTTCCTTTATAAAATGGGG - Intergenic
1133425267 16:5683002-5683024 GTTCATTCACTTACAGAATGGGG + Intergenic
1134351121 16:13438852-13438874 CTTTATTCCTTTGCAAAATGAGG + Intergenic
1134363342 16:13553233-13553255 GTTTCTTCACTTACAGAATGGGG - Intergenic
1134914878 16:18061054-18061076 GTTTCCTCCCTTATAAAATAGGG + Intergenic
1135035506 16:19073577-19073599 GTTTAACCCATTTCAAAATCAGG - Intronic
1137752360 16:50875963-50875985 GTTTAATCACTTGCAAAATGAGG + Intergenic
1139003063 16:62538034-62538056 GTTTATTGTCTTAAAAAATTAGG - Intergenic
1139017704 16:62710243-62710265 GTTTAATCCATTTCCAAATCTGG + Intergenic
1139286117 16:65815962-65815984 GATGCTTCCCTTACAAAATGGGG + Intergenic
1139303584 16:65964781-65964803 GGGAAGTCCCTTACAAAATCTGG - Intergenic
1142034704 16:87855842-87855864 GTTTATTACCTGAAAGAATCAGG - Intronic
1144549851 17:16230474-16230496 GTTTCTTCCCCTATAAAATGAGG - Intronic
1145105130 17:20109086-20109108 GTTTATTCACTTTCAAACTATGG + Intronic
1147015377 17:37488083-37488105 GTTTATGCCTTTACAGAATGTGG - Intergenic
1149620989 17:58044881-58044903 GTTTTCTCCATAACAAAATCAGG - Intergenic
1153589411 18:6657644-6657666 GTATATTCCTTGACAAAGTCTGG + Intergenic
1154439223 18:14372865-14372887 GTTTATTTGCCTTCAAAATCTGG - Intergenic
1155790220 18:29957970-29957992 GTTTATTCCTTCTCATAATCAGG - Intergenic
1156109850 18:33713141-33713163 GTTTGTTACTATACAAAATCAGG + Intronic
1157033562 18:43943466-43943488 GTTTCTTCACTTACAAAAATGGG - Intergenic
1157218196 18:45802831-45802853 GTTTATACCTTTCCCAAATCAGG + Intergenic
1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG + Intronic
1159765572 18:72484395-72484417 GTTTATTTGCTTTCAAAATAAGG + Intergenic
1165674811 19:37713006-37713028 GTTTATTTCGTTCCTAAATCTGG + Intronic
1166725162 19:45022415-45022437 GTTTCTTCCTCTACAAAATAGGG - Intronic
924998190 2:383138-383160 TTTTTTTCTCTTACAAAGTCAGG - Intergenic
927824940 2:26301798-26301820 GTTTATTCACATACAAAAAAAGG - Intergenic
930274307 2:49293745-49293767 GTTTATTCACCTACAAAATGAGG + Intergenic
930744541 2:54868487-54868509 GTTTATTCTCTTAAATAATTAGG + Intronic
932427231 2:71645766-71645788 GTATTTTCACTTACTAAATCTGG + Intronic
933678391 2:85077797-85077819 TTTTAGTTCCTTTCAAAATCAGG - Intergenic
935275117 2:101469603-101469625 GATAATTCCCTAACTAAATCTGG - Intronic
936601043 2:113894755-113894777 GTTTTTTCACTTATAAAATTAGG - Intronic
937021752 2:118663697-118663719 GTTTATTCCATTCAGAAATCTGG - Intergenic
941438834 2:165507877-165507899 TTTTATTCTCTTAAAAAATGTGG - Intronic
942297973 2:174535543-174535565 GTTTCTTCACTTGCAAAATCAGG + Intergenic
943371440 2:187021598-187021620 GTTTACCCACTTACAAAATTAGG + Intergenic
943518588 2:188918646-188918668 GTATATTCCTATTCAAAATCAGG - Intergenic
943949346 2:194110409-194110431 GTTTATTCATTAAAAAAATCAGG + Intergenic
944204825 2:197147018-197147040 GTTATTTACCTGACAAAATCAGG + Exonic
944668487 2:201975902-201975924 GTTTCTTCCCTTGTAAAATGAGG - Intergenic
945018678 2:205548584-205548606 GTTTATGCTCTTACAATCTCTGG + Intronic
945264081 2:207873020-207873042 GTTCATTCCCCTACATGATCAGG - Intronic
945805071 2:214480240-214480262 TTTTATTACCATACAATATCAGG - Intronic
946946989 2:224831593-224831615 ATTTATTTCATGACAAAATCTGG - Intronic
947030962 2:225794277-225794299 GTTTATTGCCTTACATAGTATGG - Intergenic
947573953 2:231257668-231257690 GTTTCCTCACTTACAAAATGAGG + Intronic
947911024 2:233801092-233801114 GTTTCTTCATCTACAAAATCAGG - Intronic
1169826598 20:9775254-9775276 TTTTTTCCCCTTAAAAAATCAGG - Intronic
1172400023 20:34642144-34642166 GTTAATTGCCTAACAAAGTCAGG - Intronic
1173397227 20:42690827-42690849 GTTTCTTCCCATGTAAAATCAGG + Intronic
1174855818 20:54044138-54044160 GTTTATTCTATTTCAAGATCTGG + Intronic
1176456458 21:6916543-6916565 GTTTATTTGCCTTCAAAATCTGG + Intergenic
1176697376 21:9995986-9996008 TTTTATTCACTTAAAAAATCAGG - Intergenic
1176813790 21:13575645-13575667 GTTTTTTGCCCTACAAAATGTGG - Intergenic
1176834632 21:13781603-13781625 GTTTATTTGCCTTCAAAATCTGG + Intergenic
1177326118 21:19591081-19591103 CTTTATTTCCTTACAAGATATGG - Intergenic
1179020762 21:37638678-37638700 GTTTATTCTCTGCCCAAATCTGG + Intronic
1181392446 22:22593575-22593597 ATTGATTCCCTAATAAAATCTGG + Intergenic
1182192808 22:28480942-28480964 GTTTATTCATTTATAAAATGAGG - Intronic
950999861 3:17545252-17545274 ACTTATTCCCTTATAAAATGGGG + Intronic
951190243 3:19760312-19760334 GTTTTTTCCTTTTCAAAAGCTGG + Intergenic
951319762 3:21230125-21230147 GTTGATTCACTTACATGATCTGG + Intergenic
951385880 3:22041987-22042009 TTTTATTGCCTTACAAAAGTTGG + Intronic
951421474 3:22490980-22491002 ATTTATTTCCTGACTAAATCTGG + Intergenic
953134798 3:40173224-40173246 GTTTATTCCTTTGTAAAATGGGG - Intronic
953242848 3:41165248-41165270 GGTTATTCCCTCATAAAATGGGG - Intergenic
954079738 3:48206692-48206714 GTTTCTTCCCTTGCCAAATGGGG + Intergenic
955787464 3:62555544-62555566 GTTTCTTCATTTACAAAATGGGG + Intronic
956868256 3:73390433-73390455 TTTTATTTCCTGACAAAATTGGG + Intronic
957716246 3:83932932-83932954 TTTTAGTCCCCTACAAAATATGG + Intergenic
958643219 3:96835836-96835858 GTTTATTTCCTTAACAAATGTGG + Intronic
959653657 3:108776456-108776478 GTTTTTTCACTTGCAAAATGGGG - Intergenic
961054280 3:123774712-123774734 ATTTATTCAATTACAAAATAAGG - Intronic
963262290 3:143205139-143205161 GTTTCTTCACCTACAAAATTAGG + Intergenic
964897932 3:161620723-161620745 GTATTTTCCCTTACCTAATCTGG - Intergenic
966028181 3:175311828-175311850 TTTTTTTCCTTTACAAAAGCAGG + Intronic
967320894 3:188194057-188194079 GTTTCTTCCCTGAAAAAATCAGG + Intronic
967723829 3:192843161-192843183 TGTTATTCCCTTAGTAAATCTGG - Intronic
969146297 4:5126847-5126869 ATTCATTCCCTAAAAAAATCAGG - Intronic
970538838 4:17057149-17057171 GTTTCTACCTCTACAAAATCGGG + Intergenic
970832810 4:20362671-20362693 GTTTATTCACTTAAAAAGTAAGG + Intronic
971606222 4:28661423-28661445 GTTTATATACTGACAAAATCAGG - Intergenic
972266150 4:37461903-37461925 CTTTATTCCCTTAGAAGATCTGG - Intronic
975254721 4:72219201-72219223 GCTTTTTCCCTTACAGAATTTGG - Intergenic
976814782 4:89135111-89135133 GTTTCCTCACTTACAAAATGAGG + Intergenic
978109511 4:104945674-104945696 GTTTATTTCCTAATAATATCAGG + Intergenic
978256608 4:106699902-106699924 GTTTATTCCATTAAAAAGTTTGG + Intergenic
978712064 4:111795768-111795790 GTATATTCCTTTCCAATATCAGG + Intergenic
979025520 4:115568646-115568668 TTTTATATCCTTACAAACTCTGG + Intergenic
980726703 4:136770673-136770695 GTTAATTTCCTTAAAGAATCTGG + Intergenic
980900860 4:138903978-138904000 ATTTCTACCCTTACAAAATGAGG + Intergenic
981041563 4:140227695-140227717 GTTTATTCATTTGCAAAATGAGG + Intergenic
981374944 4:144004054-144004076 ATTTGTACCCTTACAAAAACTGG + Intronic
989290820 5:39762856-39762878 GTCTTTTCACTTACAAAATTGGG - Intergenic
989995659 5:50827008-50827030 TTTTATTCACTTAAAAAGTCAGG - Intronic
990454292 5:55970024-55970046 GTATATTTCTTTACAAATTCAGG - Intronic
991491211 5:67184398-67184420 GTTTATTCCAGTGCACAATCTGG - Exonic
995961627 5:117847052-117847074 TTTTATTCCCTTAGAAAGCCTGG - Intergenic
996805395 5:127448651-127448673 ATTTATTCTCATACAAATTCAGG + Intronic
996949292 5:129106742-129106764 GTTTATTCATTTGTAAAATCAGG - Intronic
997721505 5:136081423-136081445 GTTTATTCATTTGCAAAATGGGG - Intergenic
998969166 5:147572476-147572498 GTTTCTTCTTTTGCAAAATCAGG + Intergenic
999364919 5:151016569-151016591 GTTTCTTCATTTACAAAATGGGG + Intergenic
1000110522 5:158103833-158103855 GTTTCTTCACTTACAGAATCTGG - Intergenic
1001672006 5:173481492-173481514 TTTTTTTTCTTTACAAAATCTGG - Intergenic
1001843109 5:174897255-174897277 GTTTATTCCTTTACATAGTATGG + Intergenic
1002988232 6:2212568-2212590 TTTTATTCCCTTGCAAAACATGG - Intronic
1004438508 6:15622184-15622206 GTTTATTCTTTTACAAAATTTGG - Intronic
1004804139 6:19183637-19183659 GTTTATAGCCTTACAAAACGAGG - Intergenic
1005230271 6:23693193-23693215 CTTTATTCCCTTAAAAATTTAGG + Intergenic
1005367185 6:25090376-25090398 GTTTCTTCCCCCACAAAATGGGG + Intergenic
1008818094 6:55593844-55593866 GATTTTTCACTTCCAAAATCGGG - Intergenic
1008920453 6:56838741-56838763 GTTTATTGCCTCACACAATAAGG - Intronic
1009355141 6:62734499-62734521 GATTCTTCCCTTAAAAATTCAGG - Intergenic
1010161747 6:72864429-72864451 GTTTGTTCACTGAGAAAATCTGG + Intronic
1011096151 6:83666168-83666190 GTTTACTCTCTTACAAACTCAGG - Intronic
1011439729 6:87374709-87374731 GTTTCTTCACTTACAAAATGAGG + Intronic
1012060985 6:94480496-94480518 GTTTATTGCCTGACAAATGCAGG + Intergenic
1012367216 6:98456498-98456520 ATTTATTCCCTAACAAAAGAGGG + Intergenic
1014145591 6:117994568-117994590 GTTTCTTCACTTATAAAATAGGG - Intronic
1014821515 6:125993486-125993508 TTTTTTTCCTTTCCAAAATCAGG + Intronic
1015035423 6:128647786-128647808 GTTTTCTCACTTACAAAATGAGG + Intergenic
1016206097 6:141470603-141470625 GTTTTTTCCCCTCCAAAATGGGG + Intergenic
1017328856 6:153172425-153172447 GACTAGTCCCTTACAAAATATGG + Intergenic
1018526818 6:164720794-164720816 GTTTATTCAGATACAAAATTAGG + Intergenic
1021270336 7:18577133-18577155 GTTTATTCCCTTACAAAATCTGG - Intronic
1022367456 7:29737523-29737545 ATTTATTCCCTTTCAAATTTTGG - Intergenic
1022928733 7:35086357-35086379 ATTTATTCTCTTTCAAATTCTGG + Intergenic
1023320059 7:38986409-38986431 GGTTATTTCCTTCCAAAAACAGG + Intronic
1023342868 7:39240504-39240526 GTTTCTGGCCTTACAAAATTGGG - Intronic
1023572047 7:41582366-41582388 GTTTGTACCCTGAAAAAATCTGG + Intergenic
1023593854 7:41808475-41808497 GTTTATTCATTTGTAAAATCTGG + Intergenic
1023781544 7:43660531-43660553 GCTTCTTCACTTACAAAATAGGG - Intronic
1024476429 7:49816852-49816874 GTTTCTTCACTTACAAAATTGGG + Intronic
1025969662 7:66310515-66310537 CTTTATTCCCTTACACACTGAGG - Intronic
1026378710 7:69777698-69777720 GTTTTTTCCCTTTAAAAATTAGG + Intronic
1028997524 7:97117580-97117602 GTTTGGTCCCTTGCACAATCAGG - Exonic
1030932813 7:115546082-115546104 ATGTATTCCCTTGCAAAATATGG - Intergenic
1031824747 7:126549764-126549786 GTTTATTGCATTACATATTCAGG - Intronic
1032746242 7:134789488-134789510 CTTTTTTCACTTACAAAATGGGG + Intronic
1032754295 7:134873761-134873783 GTATCCTCCCTTACAAAATGGGG + Intronic
1034792552 7:153984457-153984479 TTTTCTTCCCTTGCAAATTCTGG + Intronic
1037793331 8:21967716-21967738 GTTTATTGCCTTACAAATCCAGG + Intronic
1040778918 8:51082901-51082923 GTTTATTCCCTTCCTTACTCTGG - Intergenic
1041457923 8:58080201-58080223 GTTAATTGCTTTACAATATCAGG + Intronic
1042011892 8:64255668-64255690 TTTTATTTCTTTACAAAAGCAGG - Intergenic
1044589967 8:93904702-93904724 CTTATTTCCCTGACAAAATCTGG + Intronic
1046441766 8:114265002-114265024 GATTATACCTTTAAAAAATCTGG + Intergenic
1046988680 8:120423318-120423340 GTTTCTTCCCTTTGGAAATCTGG - Intronic
1047326900 8:123848240-123848262 GTAGATTCCCAAACAAAATCAGG - Intergenic
1050380972 9:5029520-5029542 GTTTTTTTCTTTACAAAATAAGG - Intronic
1050833585 9:10047734-10047756 GTTTACTTCCTTGAAAAATCAGG + Intronic
1051074421 9:13213979-13214001 GTTTCTTCACTTACAAAGTTGGG - Intronic
1051536003 9:18158535-18158557 ATTAATTCCCTTTCAAAAACAGG + Intergenic
1052343037 9:27381598-27381620 TTTAATTCCATCACAAAATCAGG - Intronic
1052692259 9:31830060-31830082 GTTTAGTTCCTTACAAATTTTGG - Intergenic
1052730925 9:32284258-32284280 GTTTACTCACTTGCAAAATGAGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053341659 9:37341171-37341193 GTATATACTCTGACAAAATCAGG - Intronic
1055175143 9:73309414-73309436 GTTTATTTCCTTTCTAAATCAGG + Intergenic
1056481457 9:87010801-87010823 GTTTTTTCACTCACAACATCAGG + Intergenic
1187952271 X:24482605-24482627 ATTTATTCTGTTACACAATCAGG + Intronic
1190036547 X:47030561-47030583 GTTTACTCCCTAACAGAATGGGG + Intronic
1195095868 X:101500527-101500549 GTTTAATCCCCTGCAAAATGTGG + Intronic
1197886449 X:131222991-131223013 GTTTATTCCATTACTAATTAAGG - Intergenic
1198112144 X:133511026-133511048 ATTTAGTTCCTCACAAAATCAGG - Intergenic
1199821117 X:151447860-151447882 GTTGATTTCCTTATAAATTCTGG - Intergenic