ID: 1021272152

View in Genome Browser
Species Human (GRCh38)
Location 7:18603122-18603144
Sequence CACACTAAACAGAAGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021272152 Original CRISPR CACACTAAACAGAAGGATGT TGG (reversed) Intronic
900849457 1:5130780-5130802 CACACTAAGCATAAGGCTCTAGG + Intergenic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
901939703 1:12652581-12652603 CACACTCAAGAAAAGGAAGTGGG + Intronic
902577246 1:17386177-17386199 CCCATTAAACAGAAGCATGGGGG - Intronic
904367924 1:30028480-30028502 CACAAGAAACAGTGGGATGTGGG + Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
908390651 1:63680623-63680645 CACCCTGAACAGGAGCATGTGGG + Intergenic
908662420 1:66451444-66451466 CACACAAAACAAAAAGAAGTTGG + Intergenic
911294418 1:96097162-96097184 TAAACTAAACAGATGGATGTGGG + Intergenic
912625182 1:111200355-111200377 CACCCTAAAAACAAGGAAGTAGG + Intronic
913484428 1:119320773-119320795 CACCCTAGACAGAAAGATTTGGG - Intergenic
915990504 1:160511516-160511538 CACATTCAACAGAATGAAGTTGG + Intronic
916975879 1:170077198-170077220 AACACCAATCAGCAGGATGTGGG + Intronic
917085015 1:171296520-171296542 CTCACTTAACAGAAGGCAGTTGG - Intergenic
917406455 1:174712174-174712196 CAGACCAATCAGCAGGATGTGGG + Intronic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918384689 1:183993813-183993835 CTCTCTAAACATCAGGATGTGGG - Intronic
921134395 1:212247313-212247335 CACAATACACAGAAGAATGCTGG - Intergenic
1064287423 10:14004016-14004038 GAGACCATACAGAAGGATGTGGG + Intronic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1067096672 10:43305794-43305816 CACACTAAACATGAAGCTGTGGG - Intergenic
1068263008 10:54607983-54608005 CACAATAACCAAAATGATGTAGG - Intronic
1068358946 10:55950578-55950600 CATGCTAACCAGAAGCATGTAGG + Intergenic
1071661862 10:87512356-87512378 CACACTAAAGAGAGAAATGTTGG - Intronic
1073375112 10:103027148-103027170 CACAATAAATTGAAGGAAGTTGG - Intronic
1075794449 10:125109166-125109188 TTCTCTAAACAGAAGGATGTGGG - Intronic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1076353221 10:129832771-129832793 CACAGGATACAGAAGCATGTGGG - Intergenic
1078603723 11:12756657-12756679 CTCACTAGACAGTAGGATGTAGG - Intronic
1080820395 11:35800396-35800418 CACAACAATCAGCAGGATGTGGG - Intronic
1082995121 11:59247940-59247962 TACAAGAAACAGAAGGAAGTGGG + Intergenic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1084764083 11:71296293-71296315 CACATTAAAAAAAACGATGTAGG + Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1088913837 11:114212070-114212092 CACACTGTACAAAAGGAGGTGGG - Intronic
1089836179 11:121372708-121372730 CTCACTCAACAGAAGGTAGTAGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093208775 12:16282967-16282989 CACACTGGACAGAAGGATCAAGG - Intergenic
1094430302 12:30360974-30360996 CACAATAAAAAGAAGAATATAGG - Intergenic
1095242357 12:39876264-39876286 CACACAAAACAGAAACATATAGG + Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655746 12:53090594-53090616 CCCACAAAACAAAAGGATGGGGG - Intergenic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1106750664 13:32763063-32763085 CCCACTAAACAGACGGAATTTGG - Intronic
1109237123 13:59837356-59837378 CACAAGAAACTGAATGATGTCGG - Intronic
1110034751 13:70669125-70669147 CATACTGAAAAGCAGGATGTTGG + Intergenic
1111680089 13:91431357-91431379 CACATTATACAGAAAGATCTAGG - Intronic
1114735041 14:25035321-25035343 CACTCAAAAAATAAGGATGTGGG + Intronic
1117094351 14:52282352-52282374 CTCACTCAACAGAAGGCAGTAGG + Intergenic
1117475273 14:56088064-56088086 CACATTAAACACAAGTTTGTGGG + Intergenic
1119794614 14:77384783-77384805 CACTCTTAACAGAAAGATCTAGG + Intronic
1120106521 14:80501761-80501783 CACACCAAAGAAAAGGAGGTGGG - Intronic
1123628779 15:22246321-22246343 CTCAGAAAACAGGAGGATGTGGG + Intergenic
1125208989 15:37189301-37189323 CACACTACTCAGAACAATGTGGG + Intergenic
1125211628 15:37222857-37222879 CAAACTAAACAAAAGCACGTCGG - Intergenic
1127355264 15:58192992-58193014 GACACCAAACAGCAGAATGTGGG + Intronic
1130024332 15:80258453-80258475 GACACTAAACAGAAACAGGTAGG - Intergenic
1130521680 15:84666417-84666439 CACACAAAAAAGAAGGAAGCAGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG + Intronic
1142510739 17:391168-391190 CACACAAAACAGCCGGGTGTGGG - Intergenic
1143095982 17:4478624-4478646 CACACCTACCAGCAGGATGTCGG - Exonic
1143662582 17:8335832-8335854 CACACAACACAGAAGAATCTTGG - Intergenic
1150610213 17:66727540-66727562 GACCCTAAACATCAGGATGTGGG - Intronic
1151923483 17:77175351-77175373 CACACTTCACAGAAGGGGGTGGG + Intronic
1153935567 18:9917682-9917704 CACTCTCAACATAAGGATTTTGG - Intronic
1155457585 18:26035272-26035294 CAAACCAAACAGAAGGATTTCGG + Intronic
1156984101 18:43328721-43328743 CACATTAATAAGAAGCATGTAGG - Intergenic
1159140985 18:64394342-64394364 TACACTAAAGAGAAGAAAGTTGG + Intergenic
1160131737 18:76231431-76231453 CAGACTAATCAGAAGGAAATGGG - Intergenic
1160199953 18:76788160-76788182 CAGACCAATCAGCAGGATGTGGG - Intergenic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1167909669 19:52691204-52691226 CACACGGAACAGAATAATGTTGG - Intergenic
926214343 2:10894926-10894948 CACACCAAACAAGAGGATGCAGG - Intergenic
929175551 2:38971948-38971970 AACACTAAACAGTTGCATGTTGG + Intronic
930681760 2:54264378-54264400 CACACCAATCAGCAGGATGTGGG - Intronic
931471496 2:62542720-62542742 GACACTAACCAAGAGGATGTTGG + Intergenic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
937023175 2:118676934-118676956 CCCACTTCACAGAAGGATTTTGG + Intergenic
937327237 2:120997720-120997742 CAAACTATACAAAAGGATGTAGG + Intergenic
937708731 2:124952579-124952601 TACACTTACCAGAAGGATGCTGG + Intergenic
937771878 2:125728982-125729004 CTGACCAAACAGCAGGATGTGGG + Intergenic
941275628 2:163487099-163487121 AGCAGTAAACAGAAAGATGTGGG - Intergenic
941476476 2:165956632-165956654 CAGACCAATCAGTAGGATGTGGG - Intergenic
941988281 2:171529589-171529611 CAGTCTACTCAGAAGGATGTAGG + Intronic
944368345 2:198951126-198951148 CACAATAGAAAGCAGGATGTTGG - Intergenic
1168950356 20:1794787-1794809 CACACTAATCAAAAGGATACTGG + Intergenic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1173571684 20:44081249-44081271 CTCACAAGAGAGAAGGATGTTGG - Intergenic
1177771858 21:25525911-25525933 GACATTAAAGAGAATGATGTAGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178778597 21:35576714-35576736 CAAACAAGACAGAAGGATCTTGG + Intronic
1182700585 22:32234256-32234278 CACACTGAGCACAAGGATTTAGG + Intronic
1183204579 22:36409952-36409974 GACACAAAACATAAGGACGTTGG - Intergenic
1184284190 22:43458846-43458868 CACAATAACCAGAAGGCAGTGGG - Intronic
1185196638 22:49474895-49474917 CCCACTACACAGAGGGATGTCGG + Intronic
950325366 3:12104024-12104046 AACACTAAACATAAGGATGTTGG + Intronic
951112119 3:18816240-18816262 CACACTCAAAAGAATGAAGTTGG - Intergenic
952158622 3:30670858-30670880 CACACTGAAAAGAGGAATGTTGG + Intronic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
955066362 3:55536689-55536711 TACACTAAACAAACGGGTGTGGG + Intronic
955257552 3:57349306-57349328 CACACAAAAAAAATGGATGTTGG + Intronic
956345577 3:68274349-68274371 AACACTAGACAGAAAAATGTTGG - Intronic
956641800 3:71422721-71422743 CACACTTCAGAGAAGGATCTAGG + Intronic
956978699 3:74612810-74612832 CTCACTAAATGGAAGGATGTTGG - Intergenic
957218100 3:77347839-77347861 CACTCTAAAGAAAAGGATTTGGG - Intronic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
959370394 3:105517372-105517394 CACACTAGACAGAGGGCAGTAGG - Intronic
959390696 3:105769904-105769926 GAGACTAATCAGAAGGTTGTTGG + Intronic
959844299 3:111015067-111015089 CAAACTAAACACAAGTTTGTCGG + Intergenic
962857514 3:139361351-139361373 CACAGTTAACAGAATAATGTTGG - Intronic
964775789 3:160275229-160275251 CCCACTAAACATTAGTATGTGGG + Intronic
964775949 3:160277395-160277417 CCCACTAAACAGTAGTATGTGGG + Exonic
964978627 3:162649840-162649862 CACAATAATCAGCAAGATGTGGG + Intergenic
965433988 3:168624455-168624477 CACAGTACTCTGAAGGATGTAGG + Intergenic
966073899 3:175912231-175912253 CAAACTAAATTGAAGGATTTAGG + Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966392115 3:179463981-179464003 CTCACTAAAAAGAAGGGGGTGGG + Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
972081283 4:35153507-35153529 GACACTAAAAAGAAGAAAGTAGG - Intergenic
972098645 4:35382758-35382780 TATAATAAACAGAAGTATGTTGG - Intergenic
976734783 4:88298501-88298523 CTCACTAAACATAATGTTGTGGG - Intergenic
978593759 4:110354910-110354932 CCCACCACACAGAAGAATGTAGG - Intergenic
979734706 4:124068991-124069013 CACAATGAACAAAAGAATGTTGG + Intergenic
982928710 4:161373833-161373855 CACATAAAACAGAAGACTGTGGG - Intergenic
984066425 4:175053787-175053809 AACAGTAAGCAGCAGGATGTAGG + Intergenic
985103334 4:186479103-186479125 ATCACTAAACAGCAGGATGGGGG + Intronic
988526615 5:31992830-31992852 CACACTTGAGAGAAGGATGCTGG - Intronic
989247052 5:39266250-39266272 CACACTATGAATAAGGATGTAGG + Intronic
989967244 5:50478852-50478874 CAAATTAAAGAGAAGGATATAGG + Intergenic
991104148 5:62825095-62825117 CACAATAAAAAGAAGTATGTCGG - Intergenic
992266279 5:75021274-75021296 ATCACAAAACATAAGGATGTGGG - Intergenic
992725535 5:79603466-79603488 CAGACATAACAGAAGCATGTTGG + Intergenic
993918268 5:93768397-93768419 CACTCTAAATAAAAGGAAGTGGG + Intronic
995487123 5:112650450-112650472 CACACTAAGCGCAAGGATGGTGG + Intergenic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
1000248315 5:159468917-159468939 CACACAAAAAAGAGGGATTTGGG + Intergenic
1001682853 5:173571308-173571330 AAAACTAAAGAGAAGGTTGTAGG - Intergenic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1003790069 6:9536227-9536249 CACACTGCACAGAAAGATGATGG - Intergenic
1003896888 6:10616444-10616466 CAGACCAATCAGCAGGATGTGGG - Intronic
1004259151 6:14093215-14093237 GACACCAAAAAGAAGGATTTAGG + Intergenic
1011974871 6:93283331-93283353 CAGACCAATCAGCAGGATGTGGG + Intronic
1013687919 6:112607917-112607939 CACACTACACAGAAGTAGTTGGG - Intergenic
1014700680 6:124683842-124683864 CACACTAGCCAGAACCATGTGGG - Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1022290002 7:28992151-28992173 GACACTTAACAGAGGTATGTAGG + Intergenic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1023190978 7:37582339-37582361 CACATGAAACAGAAGGAATTTGG - Intergenic
1027779071 7:82500378-82500400 CAGACCAATCAGCAGGATGTGGG + Intergenic
1030334545 7:108310470-108310492 CTTCCCAAACAGAAGGATGTGGG + Intronic
1030484928 7:110153220-110153242 CACACTAAAGAGAACTAAGTTGG - Intergenic
1030719520 7:112853483-112853505 CACACCAAACAAAATTATGTAGG - Intronic
1030995357 7:116352819-116352841 GAGTCTACACAGAAGGATGTGGG + Intronic
1031256625 7:119459462-119459484 CACACTAAACACAACAATCTAGG - Intergenic
1031518309 7:122729317-122729339 CACAATAAACATGAGGATGCAGG + Intronic
1033013640 7:137649037-137649059 AACTCTGAACAGAAGGATGCTGG - Intronic
1034122628 7:148641195-148641217 CACACCAGACAGAAGGTGGTTGG + Intergenic
1034686662 7:152977859-152977881 CACATTAAACAGAACGCTATTGG - Intergenic
1036028960 8:4944384-4944406 CACACTATTCAGATGGTTGTAGG + Intronic
1039588577 8:38728037-38728059 AACAAAAAACAGAGGGATGTGGG + Intergenic
1043155432 8:76772704-76772726 AACTCGAAACAGAATGATGTGGG - Intronic
1043184932 8:77136419-77136441 CACAATAAACATGAGGGTGTAGG + Intergenic
1044244013 8:89919856-89919878 CAAACTAAATAGAAGTATGCAGG - Intronic
1045288848 8:100814583-100814605 CACACTAAGTAGAAGGTTATAGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046910121 8:119617396-119617418 CACACTAACCAGTGGGCTGTGGG - Intronic
1047398861 8:124529119-124529141 CACACTTCACAAAAGGGTGTGGG - Intronic
1047549355 8:125852890-125852912 CCCACTAGAAAGAGGGATGTTGG - Intergenic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1049926458 9:413203-413225 CACACTCAAAAGAATGAAGTTGG + Intronic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1052313565 9:27093519-27093541 CAGACCAATCAGCAGGATGTGGG + Intergenic
1052645031 9:31223691-31223713 CACATGCAATAGAAGGATGTTGG + Intergenic
1052795948 9:32923635-32923657 CAAATCAAACAGAATGATGTTGG + Intergenic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1055590624 9:77809490-77809512 CACAAAAAACAGATGGTTGTAGG - Intronic
1056733203 9:89183299-89183321 CACACTAAAGAGGTGAATGTGGG - Intergenic
1057364352 9:94405036-94405058 CACATTAAAAAGAATGAAGTTGG - Intronic
1057658979 9:96983033-96983055 CACATTAAAAAGAACGAAGTTGG + Intronic
1058142536 9:101372515-101372537 CACACTAATCAAAAGGAGATGGG - Intronic
1058292316 9:103257601-103257623 CACAGAAAACAGGAAGATGTGGG - Intergenic
1058960727 9:109990454-109990476 GACACTATACAGAAATATGTGGG - Intronic
1059791037 9:117642361-117642383 TCTACTAAACAGCAGGATGTGGG - Intergenic
1186087191 X:6003211-6003233 CACACTTAACAAAAGGGGGTGGG + Intronic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1190304421 X:49073981-49074003 CACATTAACCGGCAGGATGTCGG - Exonic
1192575529 X:72240321-72240343 GACACTAAATAGGAGGTTGTGGG + Intronic
1193969037 X:88027696-88027718 CACACTGAACAGAACCAAGTTGG - Intergenic
1194464259 X:94212720-94212742 CACACTAAAAATATGTATGTTGG + Intergenic
1194589576 X:95782426-95782448 CATACTAATCAGAAGAAAGTTGG + Intergenic
1194784842 X:98070052-98070074 CACACTAAAAAGACTGATATCGG - Intergenic
1196815399 X:119661734-119661756 AAAACAAAACAGAAAGATGTAGG - Intronic
1201855964 Y:18542513-18542535 TAAACTACACAGGAGGATGTGGG + Intergenic
1201877357 Y:18777872-18777894 TAAACTACACAGGAGGATGTGGG - Intronic