ID: 1021273426

View in Genome Browser
Species Human (GRCh38)
Location 7:18620748-18620770
Sequence ATATCGGGGCCGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021273426_1021273433 17 Left 1021273426 7:18620748-18620770 CCTGTTACTTACGGCCCCGATAT No data
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021273426 Original CRISPR ATATCGGGGCCGTAAGTAAC AGG (reversed) Intronic