ID: 1021273426

View in Genome Browser
Species Human (GRCh38)
Location 7:18620748-18620770
Sequence ATATCGGGGCCGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 6}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021273426_1021273433 17 Left 1021273426 7:18620748-18620770 CCTGTTACTTACGGCCCCGATAT 0: 1
1: 0
2: 0
3: 0
4: 6
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021273426 Original CRISPR ATATCGGGGCCGTAAGTAAC AGG (reversed) Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
1066204509 10:33174707-33174729 ATAACGGGGCCTTAAGAAAAGGG + Intergenic
1090138718 11:124229182-124229204 ATAGGGAGTCCGTAAGTAACAGG - Intergenic
1095160191 12:38906089-38906111 ATAACGGGGCAGTTAGGAACGGG - Intronic
944965817 2:204931704-204931726 ATACAGGGCCAGTAAGTAACAGG - Intronic
1021273426 7:18620748-18620770 ATATCGGGGCCGTAAGTAACAGG - Intronic
1196942337 X:120789351-120789373 ACATCTGGGCATTAAGTAACTGG + Intergenic