ID: 1021273433 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:18620788-18620810 |
Sequence | CTGCGATGCTTCCAATGACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 96 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 92} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021273425_1021273433 | 24 | Left | 1021273425 | 7:18620741-18620763 | CCATGCTCCTGTTACTTACGGCC | 0: 1 1: 0 2: 0 3: 5 4: 70 |
||
Right | 1021273433 | 7:18620788-18620810 | CTGCGATGCTTCCAATGACTTGG | 0: 1 1: 0 2: 0 3: 3 4: 92 |
||||
1021273428_1021273433 | 2 | Left | 1021273428 | 7:18620763-18620785 | CCCGATATTGTCTTCCCATCCTA | 0: 1 1: 0 2: 1 3: 8 4: 130 |
||
Right | 1021273433 | 7:18620788-18620810 | CTGCGATGCTTCCAATGACTTGG | 0: 1 1: 0 2: 0 3: 3 4: 92 |
||||
1021273429_1021273433 | 1 | Left | 1021273429 | 7:18620764-18620786 | CCGATATTGTCTTCCCATCCTAC | 0: 1 1: 0 2: 1 3: 22 4: 171 |
||
Right | 1021273433 | 7:18620788-18620810 | CTGCGATGCTTCCAATGACTTGG | 0: 1 1: 0 2: 0 3: 3 4: 92 |
||||
1021273427_1021273433 | 3 | Left | 1021273427 | 7:18620762-18620784 | CCCCGATATTGTCTTCCCATCCT | 0: 1 1: 0 2: 0 3: 8 4: 129 |
||
Right | 1021273433 | 7:18620788-18620810 | CTGCGATGCTTCCAATGACTTGG | 0: 1 1: 0 2: 0 3: 3 4: 92 |
||||
1021273426_1021273433 | 17 | Left | 1021273426 | 7:18620748-18620770 | CCTGTTACTTACGGCCCCGATAT | No data | ||
Right | 1021273433 | 7:18620788-18620810 | CTGCGATGCTTCCAATGACTTGG | 0: 1 1: 0 2: 0 3: 3 4: 92 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021273433 | Original CRISPR | CTGCGATGCTTCCAATGACT TGG | Intronic | ||