ID: 1021273433

View in Genome Browser
Species Human (GRCh38)
Location 7:18620788-18620810
Sequence CTGCGATGCTTCCAATGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021273425_1021273433 24 Left 1021273425 7:18620741-18620763 CCATGCTCCTGTTACTTACGGCC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92
1021273428_1021273433 2 Left 1021273428 7:18620763-18620785 CCCGATATTGTCTTCCCATCCTA 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92
1021273429_1021273433 1 Left 1021273429 7:18620764-18620786 CCGATATTGTCTTCCCATCCTAC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92
1021273427_1021273433 3 Left 1021273427 7:18620762-18620784 CCCCGATATTGTCTTCCCATCCT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92
1021273426_1021273433 17 Left 1021273426 7:18620748-18620770 CCTGTTACTTACGGCCCCGATAT No data
Right 1021273433 7:18620788-18620810 CTGCGATGCTTCCAATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021273433 Original CRISPR CTGCGATGCTTCCAATGACT TGG Intronic