ID: 1021275021

View in Genome Browser
Species Human (GRCh38)
Location 7:18639859-18639881
Sequence GGCTGAAGGTTCTGAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021275018_1021275021 11 Left 1021275018 7:18639825-18639847 CCTGATAGAGCTGGGCAGAGGTG 0: 1
1: 1
2: 1
3: 9
4: 179
Right 1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG 0: 1
1: 0
2: 0
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021275021 Original CRISPR GGCTGAAGGTTCTGAAGTCC AGG Intronic
900174356 1:1285264-1285286 CGCTGGAGGCTCTGGAGTCCTGG - Intronic
900428669 1:2592067-2592089 ATCTGAGGGTTCTGGAGTCCAGG - Intronic
900955289 1:5882983-5883005 GGCTGTATCTTCTGAAGCCCAGG + Intronic
901059844 1:6466931-6466953 GGCTGAAGGTGGGGAAGTCTGGG + Exonic
902143482 1:14376555-14376577 GGCTCATGGTTCTGGAGCCCGGG - Intergenic
903327131 1:22575754-22575776 GGCTGAAGGATTTGAAGTGGGGG + Intronic
904068420 1:27773364-27773386 GGATGATGCTGCTGAAGTCCCGG - Exonic
906457043 1:46006052-46006074 GGCTGAGGGCTCTGAAGGGCTGG + Intronic
906807230 1:48791029-48791051 GGCTCATGGTTCTGGAGGCCGGG - Intronic
906919272 1:50047180-50047202 AGGTGAAGGCTCTGAGGTCCAGG - Intergenic
906953961 1:50357395-50357417 GGCTATAGGTTGTGAAATCCTGG - Intergenic
907488225 1:54791660-54791682 GACTGGAGGTCCTGAGGTCCTGG - Intronic
910000635 1:82337353-82337375 GGCTCATGGTTCTGAAGACTGGG - Intergenic
911364058 1:96915510-96915532 ACCTGTAGGTTCTGAAGTCAGGG + Intergenic
911882989 1:103265286-103265308 GGTTGAAGGTTCTTAAGTTCTGG + Intergenic
912386732 1:109274551-109274573 GCCTGAAGGGTGTGAAGCCCTGG - Exonic
914917553 1:151827843-151827865 GGCTGAGGTTTCTGAGGTCAGGG + Intronic
915321167 1:155057200-155057222 GGCTGCAGTTGCTGAAGTTCAGG - Exonic
916055445 1:161066195-161066217 GGATGAAGGGTCTGAAAGCCAGG - Intronic
918331589 1:183466202-183466224 GGCTGGAGGTTCTTGAGCCCAGG + Intergenic
918694669 1:187530340-187530362 GGCTCATGGTTCTGGAGTCTAGG + Intergenic
918857854 1:189781744-189781766 AGCTCATGGTTCTGAAGTCTGGG + Intergenic
918945974 1:191065326-191065348 GGCAGAAGGTGCTGAAGTATTGG + Intergenic
919145836 1:193633498-193633520 GGCTCACAGTTCTGAAGTCTGGG - Intergenic
919864753 1:201772344-201772366 TGCTGAAGTCTCTGGAGTCCTGG - Intronic
921198795 1:212783830-212783852 TGCTGAAGGAGCTGAATTCCTGG + Intronic
922414223 1:225405659-225405681 GGCTCATGGTTCTGGAGGCCAGG - Intronic
924127835 1:240874173-240874195 TGCTGGAGGTTGAGAAGTCCAGG - Intronic
1063170645 10:3506953-3506975 GGATGGAGGGTCTGAAGCCCCGG - Intergenic
1063379993 10:5578374-5578396 GGCCCAAGGTGCTGAAGTTCTGG + Intergenic
1063548779 10:7008090-7008112 GGAGGAGGGTTCTGAAGTACGGG - Intergenic
1064405611 10:15059414-15059436 GGCTGAAGGTGCTTGAGCCCAGG - Intronic
1065046217 10:21749429-21749451 GCATGAAGGTGCTGATGTCCAGG - Intergenic
1065777382 10:29133449-29133471 GCCTGAAGGTACTAAGGTCCAGG - Intergenic
1066644851 10:37595947-37595969 GGCTTATGGTTCTGGAGTCTGGG - Intergenic
1067145632 10:43691793-43691815 GGCTGCAGCCCCTGAAGTCCTGG + Intergenic
1070635511 10:78123575-78123597 GGCTCATGGTTCTGAAGGCTGGG + Intergenic
1070752068 10:78969810-78969832 CCCTAAAGGTTCTGAGGTCCAGG + Intergenic
1073152110 10:101319097-101319119 GGATCAAGGTTCTGAACTCTTGG + Intergenic
1073724415 10:106213052-106213074 GTCTTAAGGTCCTGAAGTACTGG - Intergenic
1075839400 10:125486718-125486740 GGCTCAGGGTTCTGAAGACTGGG - Intergenic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1077508510 11:2943170-2943192 GGCCGGAGGTGCTGAGGTCCTGG + Intergenic
1078500477 11:11869941-11869963 GGCTCAAGGTTCTGGAGACTAGG - Intronic
1079332564 11:19545873-19545895 GGCTGAAGATTCTTAGGTCAGGG - Intronic
1082093236 11:48106414-48106436 GGCTGGAGGTTATGAAGACTTGG + Intronic
1087959429 11:104329506-104329528 GTGTGAAGGTTCCGATGTCCTGG + Intergenic
1089161562 11:116441766-116441788 TTCAGAATGTTCTGAAGTCCAGG + Intergenic
1089496656 11:118911455-118911477 GGGGGAAGGTTCCAAAGTCCAGG + Intronic
1091183545 11:133628271-133628293 GTCTGAAGTTCCTGATGTCCAGG + Intergenic
1091273931 11:134337420-134337442 GGCTGAAGTTCCTGGAGCCCGGG + Intronic
1095990292 12:48029718-48029740 GGCTGAAGGGTGTGAAGGACTGG + Intergenic
1098649010 12:72941043-72941065 TGCCTAAGGTTCTGGAGTCCAGG - Intergenic
1099480613 12:83161032-83161054 GGCTGAAGGTTTTGAATTTGTGG + Intergenic
1101546397 12:105717329-105717351 TCCTGAACGTTCTGAAGTCTGGG + Intergenic
1103209483 12:119156234-119156256 AGCTGAAGGCTCTGAGCTCCAGG + Intronic
1104510765 12:129375678-129375700 TGCTGTATGTTCTGATGTCCTGG - Intronic
1104603147 12:130167103-130167125 GTCTGAAGCTGCTGTAGTCCAGG - Intergenic
1105046209 12:133005827-133005849 AGCTCAAGGTTCTGGAGGCCAGG - Intronic
1108867003 13:54936560-54936582 GGTTAGAAGTTCTGAAGTCCTGG - Intergenic
1110558235 13:76884996-76885018 GGCTGCAGGTTCTGTAGTGGAGG + Exonic
1112366917 13:98763149-98763171 GGCTGAAGGATATGAAGACTAGG + Intergenic
1112992136 13:105526665-105526687 GGCTATAAGTTCTCAAGTCCAGG + Intergenic
1117401012 14:55358529-55358551 GGCTGGAGGTCCTGAGGTTCTGG + Intronic
1119851371 14:77868942-77868964 GGCTGATGGTTGGGAAGTTCAGG + Intronic
1121086728 14:91152175-91152197 GGCTGTATTTTCTGAACTCCTGG - Intronic
1124445163 15:29723951-29723973 AGCTGAAGGATCTGGAATCCAGG + Intronic
1127432824 15:58927711-58927733 GGCTGAAAGCTCTGAAGGCCAGG - Intronic
1127992078 15:64126961-64126983 TGCTGAAGGTTCTAAACTCTAGG - Intronic
1128512499 15:68322059-68322081 GGATGGAGGTGGTGAAGTCCAGG + Intronic
1128860803 15:71070157-71070179 GGCTGCAGGATCTGGAGTACTGG - Intergenic
1129509865 15:76113481-76113503 GGTGGAAGGCTCTGAATTCCTGG + Intronic
1130242578 15:82210327-82210349 GGCTGAAGGCTTTGAAGGCTAGG + Intronic
1130457814 15:84130540-84130562 GGCTGAAGGCTTTGAAGGCTAGG - Intergenic
1135278846 16:21136699-21136721 GGTTGAATCCTCTGAAGTCCTGG - Intronic
1135954881 16:26948209-26948231 TCCTGTTGGTTCTGAAGTCCAGG + Intergenic
1136546230 16:30956719-30956741 GGCTGAGGTTTCTGAAGGCTGGG - Intergenic
1138409714 16:56829262-56829284 GGCTGATAGTACAGAAGTCCAGG + Intronic
1138555024 16:57765959-57765981 GGATGAAGAAACTGAAGTCCAGG - Intronic
1140483708 16:75277512-75277534 GGCAGAAGGTTCTGGAATTCAGG + Intergenic
1143795722 17:9334714-9334736 GGCTCATGGTTCTGAAGGCTGGG + Intronic
1144821278 17:18076438-18076460 GGCTGTAGGTGCTGAAGCTCTGG + Intergenic
1145016869 17:19404755-19404777 GGCTCAAGGTTCTGGAGGCTGGG - Intergenic
1148496895 17:48058438-48058460 GGCTGAAGAGTAAGAAGTCCTGG - Exonic
1150462461 17:65364131-65364153 GGCTGAAGGTTCTGCAGGTTGGG + Intergenic
1151842389 17:76627481-76627503 GGTTGAAGTGTCTGGAGTCCAGG + Exonic
1152652226 17:81499962-81499984 GGCTGCAGGTTCTGGAGCCGGGG + Intergenic
1153012451 18:551415-551437 AGCAGAAGGCTCTGAGGTCCTGG - Intergenic
1153819522 18:8821242-8821264 GGCTGGAGCTTCTGTAGTCCAGG - Intronic
1153853715 18:9123699-9123721 GGCTGGTGGTTGTGAAATCCTGG + Intronic
1155238725 18:23846169-23846191 GGCTCATGGTTCTGGAGTCAGGG - Intronic
1156485577 18:37463632-37463654 GGGTGAAGGCACTGCAGTCCTGG - Intronic
1158949831 18:62483788-62483810 GACTCAAGGTGCTGAAGTTCTGG + Intergenic
1160944080 19:1633140-1633162 GGCAGAAGATTCTGGAGTCCTGG - Intronic
1163628114 19:18402364-18402386 GTCTGGTGGTTCTGAAGTCTGGG + Intergenic
1165346581 19:35252275-35252297 GGCTGAAGTTTCTGTCGTCAAGG + Intronic
1167031803 19:46967185-46967207 GGCTGAAGGATCCAGAGTCCTGG - Intronic
1167633583 19:50640150-50640172 GGTTGGAGGGCCTGAAGTCCTGG - Intronic
925731145 2:6920061-6920083 GGCTGAAGCTGCTGAGGTTCAGG + Intronic
926029144 2:9570358-9570380 GGCTGAAAATTCAGAAGTCAAGG + Intergenic
926513942 2:13817425-13817447 GACTGAAGTTTCTGAATTACTGG - Intergenic
926634726 2:15167080-15167102 TACTGAAGGTTCTGAAGGCCTGG + Exonic
929898830 2:45984270-45984292 TGCTTAAAGTCCTGAAGTCCTGG + Intronic
930094996 2:47560200-47560222 GGCTGAGGGTTCTCAGGTCTGGG + Intronic
931912555 2:66917373-66917395 AGCTGAAGGTGCTGAACTTCTGG - Intergenic
932024201 2:68116986-68117008 GGCTGAAGGTTCCAAAGACATGG - Intergenic
932249038 2:70223710-70223732 GGCTGAATTTTCGGAATTCCCGG + Intronic
933439286 2:82290868-82290890 GGCTCAAGGTTTTGAAGCTCTGG - Intergenic
933857416 2:86429234-86429256 GGCAGGAGGTTCTCAAGCCCTGG - Intergenic
935447272 2:103169834-103169856 AGCTGAACCATCTGAAGTCCTGG - Intergenic
936032254 2:109081743-109081765 GGCGGCAGGTTGTGAAGTCCTGG - Intergenic
937248832 2:120510897-120510919 GGCTGCAGGATCAGAAGTCCCGG - Intergenic
943660071 2:190550214-190550236 ATCTGAAGGTTGGGAAGTCCAGG + Intergenic
946072960 2:217050156-217050178 AGCTGAAGGGTCTGAGGTCATGG + Intergenic
947287159 2:228529703-228529725 GGCTAAAAGTTCTGAATGCCTGG + Intergenic
947364305 2:229378420-229378442 GGGTGAAGGTCCTGAAGGCAGGG + Intronic
947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG + Intronic
948383312 2:237566572-237566594 GGATGAAGGTGCTGAGGGCCTGG + Exonic
948395611 2:237642828-237642850 GGCTTCAGGTTCTGAACTCTAGG + Intronic
1169392141 20:5198881-5198903 GACAGAAGGGTCTGAACTCCTGG + Intergenic
1169596727 20:7208566-7208588 GGCTCACGGTTCTGAAGGCTGGG - Intergenic
1169961174 20:11161812-11161834 GGCTGAAGGACCTCAAGTACAGG - Intergenic
1171452166 20:25243746-25243768 GGCTCATGGTTCTGAAGACTGGG + Intergenic
1173872758 20:46352080-46352102 GGCTGGAGGTTCTGGAGACCAGG + Exonic
1175023210 20:55873545-55873567 GGCTGCAGGTCCACAAGTCCAGG + Intergenic
1177719246 21:24883228-24883250 GGCTTTAGATTCAGAAGTCCTGG + Intergenic
1178468293 21:32869193-32869215 GGTCGGAGGATCTGAAGTCCGGG + Intergenic
1179137793 21:38695930-38695952 GACTCAAGGTTGTGAAGTCTGGG + Intergenic
1179521236 21:41946582-41946604 GGCTGATGGTTCTGCTGTCCAGG - Intronic
1179541798 21:42087787-42087809 GGCTGAAGAGTCTGAAATCAAGG + Intronic
1179549894 21:42137335-42137357 GGCTGATGGATCTGAAGCACGGG - Intronic
1182741760 22:32572777-32572799 AGCTGGAGTTGCTGAAGTCCTGG - Intronic
1184100074 22:42337328-42337350 AGCTGAAGGTACTGAAGACTGGG - Intronic
1184583883 22:45434792-45434814 GGCTGAGAGTTTTGAAGCCCTGG - Intergenic
1184801390 22:46762663-46762685 GGCTCTAGGCTCTGGAGTCCCGG + Exonic
950079794 3:10213203-10213225 GAATGGAGGTGCTGAAGTCCTGG - Exonic
950435176 3:12975030-12975052 GGCTGAAGATGCTGAGGCCCTGG - Intronic
950634929 3:14307917-14307939 GCCAGAAGGGCCTGAAGTCCAGG - Intergenic
953253220 3:41265119-41265141 GGCTGAGGATTCTGCAGTGCTGG - Intronic
953490421 3:43345593-43345615 GCCTGCAGGTTCTGGAGTCCAGG + Intronic
954656591 3:52197864-52197886 GGCGTAGGGTTCTGAAGCCCAGG + Intergenic
955508468 3:59655483-59655505 TGCTGATGGCTCTGAAGTTCAGG - Intergenic
955514518 3:59713559-59713581 GGCTCATGGTTCTGAAGGCTGGG + Intergenic
956823276 3:72973161-72973183 GGCTGATGGGTCCAAAGTCCTGG + Intronic
960145700 3:114199266-114199288 GGCTCACAGTTCTGGAGTCCGGG + Intronic
960582979 3:119295957-119295979 CGCTGAAGCTTCTGAAGACAAGG - Intronic
961379556 3:126488105-126488127 GGCTGAGGTTCCTGAAGTCCTGG - Intronic
962352059 3:134663643-134663665 GAGTGCAGGTTCTCAAGTCCTGG + Intronic
965621125 3:170643280-170643302 GGCGGGAGGTTCTGAATCCCAGG - Intronic
967436015 3:189447231-189447253 GGCTGAAAGTTCTTAAGTCAGGG + Intergenic
968518897 4:1026974-1026996 GGCTGCTGGTTCTGGAGACCAGG - Intergenic
969114845 4:4865076-4865098 GGCTGGAGGATCCGAAGCCCAGG - Intergenic
969758579 4:9166552-9166574 GTGTGAAGGGTCTCAAGTCCAGG - Intergenic
970003248 4:11385569-11385591 GGCTTACGGTTCTGAAGACTGGG - Intergenic
970318544 4:14853085-14853107 GGCTTATGGTTCTGAAGTCTAGG + Intergenic
972479831 4:39486671-39486693 GGCTGAAGGATATGAAGACTGGG + Intergenic
973646655 4:52956931-52956953 GGCTGGAGTTGCTGAAATCCTGG + Intronic
975495814 4:75034979-75035001 AGCTGGAGTTTCTGAAGTTCAGG - Intronic
976468097 4:85394601-85394623 GGCTCATGGTTCTGGAGTCTGGG + Intergenic
979008284 4:115333258-115333280 CACTGAAGGTTCTTAAGTCTGGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
979732806 4:124045235-124045257 GGCTGGAGTTTCTGAAATTCAGG + Intergenic
979737773 4:124109076-124109098 GACTGTAGATTCTGAAGTCAGGG + Intergenic
980885420 4:138757429-138757451 GCCTGAAGTTTCTGAAGTCAAGG + Intergenic
981243852 4:142510992-142511014 GACTTAAGTTTCTGAATTCCTGG + Intronic
981392363 4:144206020-144206042 AGCAGAAGGTTCTGGAGTCCAGG - Intergenic
982885314 4:160772845-160772867 GGCTGCAGGTTCACAAGCCCAGG - Intergenic
983652032 4:170045149-170045171 GGCTCATGGTTCTGGAGTCCTGG - Intergenic
983928039 4:173423804-173423826 GGCTTATGGTTCTGGAGTCAGGG + Intergenic
986374973 5:7121782-7121804 TTCTGAGGCTTCTGAAGTCCTGG + Intergenic
986672831 5:10158243-10158265 GGCTGGTGGTTCTGCAGGCCAGG + Intergenic
988786904 5:34573369-34573391 GGCTCATGGTTCTGGAGTCTGGG - Intergenic
989398577 5:40984720-40984742 GGCTGCTGGTTCTGAAGGCTGGG + Intergenic
990811289 5:59726561-59726583 GGCTGAAAGTTCTGAAATTAGGG - Intronic
991170577 5:63620282-63620304 GTCTGATGGCTCTGGAGTCCAGG - Intergenic
991747490 5:69759455-69759477 GCCTCAAGCTTCTGAAGTGCTGG + Intergenic
991750239 5:69795871-69795893 GCCTCAAGCTTCTGAAGTGCTGG - Intergenic
991891426 5:71338738-71338760 GCCTCAAGCTTCTGAAGTGCTGG + Intergenic
994428279 5:99622569-99622591 CGCCAAAGGTTCTGAATTCCCGG - Intergenic
998867068 5:146515996-146516018 GGATGATGGTTCTCCAGTCCTGG + Exonic
999842897 5:155448579-155448601 GGCTCATGGTTCTGCAGTCATGG + Intergenic
1000881794 5:166706380-166706402 GGCTAAAAGTTATGCAGTCCAGG + Intergenic
1001517341 5:172365193-172365215 GGCTGATGGTTCAGAAGATCGGG + Intronic
1002056464 5:176600505-176600527 GGCTGCAAGCTCTGATGTCCGGG + Intronic
1007390777 6:41548377-41548399 GGGTGAAGATGCTGAAGTTCAGG - Intronic
1007535979 6:42589071-42589093 GGCTGGAGGATCCCAAGTCCAGG - Intronic
1009286293 6:61822417-61822439 GGCTGAAGGTACTGGAGTTGAGG - Intronic
1011409809 6:87056281-87056303 GGCTTATGGTTCTGGAGTCTGGG + Intergenic
1012228104 6:96728314-96728336 GGCTGAAGAATTTGAAGGCCAGG - Intergenic
1012249747 6:96966903-96966925 TGCTAAAGTTTCTGAATTCCAGG - Intronic
1013660317 6:112289265-112289287 GGCTCAAGTTACTGAACTCCTGG - Intergenic
1015621569 6:135137396-135137418 GACTGAAGGATCATAAGTCCTGG - Intergenic
1017229105 6:152052970-152052992 GACTGATGCTTCTGAGGTCCTGG + Intronic
1018196183 6:161357791-161357813 GGATGAAGGTTATGAAGGCATGG - Intronic
1021250652 7:18321268-18321290 GTATGAAGGTTCTGAAGGTCTGG - Intronic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1021668218 7:23009588-23009610 TCCTGCTGGTTCTGAAGTCCAGG - Intronic
1023098587 7:36689486-36689508 GGCTGAAGGGGCAGAAGTGCTGG + Intronic
1023677632 7:42647009-42647031 GGCTCATGGTTCTGGAGGCCAGG - Intergenic
1026223319 7:68419161-68419183 GGCTGAAGGTACAGAAATACTGG - Intergenic
1026576679 7:71577883-71577905 AGCTGAAGGCACTGAAGACCTGG + Intronic
1026658347 7:72276779-72276801 GGCTGATGGTTCTGAAGACTGGG - Intronic
1026869872 7:73843875-73843897 AGCTGAAGGTTCAGAAGCGCTGG + Intergenic
1026873887 7:73869076-73869098 GGCTGCAGCTTCTGAGGCCCGGG + Intergenic
1027558522 7:79696736-79696758 GGCAGGAGGATCTCAAGTCCAGG - Intergenic
1027700571 7:81465081-81465103 CTCTGACAGTTCTGAAGTCCGGG - Intergenic
1029101890 7:98138003-98138025 GGCTGCAGATTGTAAAGTCCTGG + Intronic
1029190692 7:98770004-98770026 GGCTGGAGGTTCTGAAACCAAGG + Intergenic
1031549724 7:123093520-123093542 GGCTCATGGTTCAGAAGTCTGGG - Intergenic
1031573910 7:123392815-123392837 GGCTCATAGTTCTGAAGTCTGGG + Intergenic
1032864125 7:135909077-135909099 GTCTAAAGGTTCTGAAATCCAGG - Intergenic
1034311718 7:150094668-150094690 GGCTGAAGCTTCTGGAGTCTTGG - Intergenic
1034467341 7:151237853-151237875 GGCTGAAGCTGCTGCAGCCCCGG + Exonic
1034473846 7:151271226-151271248 GGGTGAAGGTGCTGAAGGCAAGG + Intronic
1034795135 7:154005986-154006008 GGCTGAAGCTTCTGGAGTCTTGG + Intronic
1034930564 7:155158449-155158471 GTCTGGAGGCTGTGAAGTCCAGG + Intergenic
1035041363 7:155930295-155930317 AGCTGAAGTTTCTGAGGACCAGG + Intergenic
1036153369 8:6319596-6319618 GTCTGCAGGTTCTGAAGGGCAGG + Intergenic
1037008969 8:13817985-13818007 GGCTGATGATTCTGGAGTCTGGG + Intergenic
1037962108 8:23105429-23105451 GGCAGAAGCTTCTGAAGACTAGG + Intronic
1037969343 8:23160978-23161000 GGCAGAAGCTTCTGAAGACTGGG - Intronic
1038179927 8:25218070-25218092 GGCTGATGGGACTGAAATCCTGG + Intronic
1038399742 8:27274522-27274544 CGCTGAAGTTTCTTAAGCCCCGG + Intergenic
1040386590 8:46918448-46918470 GTCTGAAGGGTCTAAAATCCAGG - Intergenic
1040436485 8:47396587-47396609 TGCTGAATTTTCTGGAGTCCTGG - Exonic
1042944250 8:74138826-74138848 GACTGAAGGTTCTCAAGTAAAGG - Intergenic
1044431619 8:92114152-92114174 GGCTCAAGTTTCTGGGGTCCGGG + Intergenic
1045137046 8:99232793-99232815 TGCTGAAGCTGCAGAAGTCCTGG + Intronic
1045738791 8:105329056-105329078 TGCTTAAGCTTCTGAAGTCAGGG + Intronic
1049809201 8:144555865-144555887 GGTTCAAGCTTCTGAAATCCAGG - Intronic
1050654601 9:7813098-7813120 GGCTCACGGTTCTTAAGGCCTGG - Intronic
1052081928 9:24216860-24216882 GACTGTAGATTCTGATGTCCTGG + Intergenic
1053279408 9:36808140-36808162 CGCTGGAGGTTTTAAAGTCCAGG - Intergenic
1053359619 9:37475437-37475459 GGCTCATGGTTCTGGAGTCCAGG + Intergenic
1054803369 9:69375130-69375152 AGCTGAAGTTTCTGAAGAGCTGG + Intronic
1055506405 9:76954057-76954079 GGCTGCAGGTTCTGATGAGCAGG + Intergenic
1057182831 9:93039136-93039158 GGCTGGCGGTTCTGAAGGCCAGG - Intergenic
1059627841 9:116086703-116086725 GGTAGAAAGTTCTGAGGTCCAGG - Intergenic
1059773340 9:117448729-117448751 GGCTGAAGGTTAGGAGATCCAGG - Intergenic
1059939691 9:119346553-119346575 GGCTGATGGCTCTTAAGTGCTGG - Intronic
1061481420 9:130899229-130899251 GGCCGGAGGTTTTCAAGTCCGGG - Intergenic
1061806476 9:133140185-133140207 GGCAGAAGGTATTTAAGTCCTGG - Intronic
1061867056 9:133497706-133497728 AGCTGAAGGCACTGAAGTGCAGG - Intergenic
1062094212 9:134694716-134694738 GGCTGCAGGGACTGAAGCCCAGG + Intronic
1185934906 X:4245497-4245519 GTCTGAAGCTTCTGGAGTCCAGG + Intergenic
1186526587 X:10254776-10254798 GGCTGAAGGGCTTGAAGTACAGG - Intergenic
1186926956 X:14344006-14344028 GCCAGAAGATTCTGAAATCCAGG - Intergenic
1187176146 X:16897928-16897950 GGCTGGAGGGTCTGGAGACCAGG + Intergenic
1187882198 X:23857752-23857774 GGCTCTAGGTTTTGAGGTCCTGG - Intronic
1188750261 X:33896305-33896327 GGCTTATGGTTCTGAAGCCTGGG - Intergenic
1189236932 X:39494439-39494461 GCCTTCAGGTTCTGAAGACCTGG - Intergenic
1194518746 X:94892337-94892359 GGCTGAAGGTCCAAAAGCCCAGG + Intergenic
1196920356 X:120579065-120579087 GGCTGGAAGTTCTGAATGCCTGG - Intergenic
1197255593 X:124259734-124259756 GCCTGAAAGTTCAGAAATCCAGG + Intronic
1197312050 X:124916879-124916901 GGCTCACGGTTCTGAAGGCTGGG - Intronic
1200107158 X:153720948-153720970 GGCAGAAGATTTTCAAGTCCCGG - Exonic
1200206334 X:154319347-154319369 GTCTGGAGGTTCTGCACTCCAGG + Intronic
1200933949 Y:8722055-8722077 GGATGAGAGTTCTGAAATCCAGG - Intergenic