ID: 1021279096

View in Genome Browser
Species Human (GRCh38)
Location 7:18694797-18694819
Sequence TTCCATTTGCATAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279096_1021279100 -7 Left 1021279096 7:18694797-18694819 CCCTCCAGTTTATGCAAATGGAA 0: 1
1: 0
2: 0
3: 26
4: 244
Right 1021279100 7:18694813-18694835 AATGGAACTTTTTCTTCAAAGGG 0: 1
1: 0
2: 6
3: 42
4: 523
1021279096_1021279101 6 Left 1021279096 7:18694797-18694819 CCCTCCAGTTTATGCAAATGGAA 0: 1
1: 0
2: 0
3: 26
4: 244
Right 1021279101 7:18694826-18694848 CTTCAAAGGGACAATATCCTTGG No data
1021279096_1021279102 7 Left 1021279096 7:18694797-18694819 CCCTCCAGTTTATGCAAATGGAA 0: 1
1: 0
2: 0
3: 26
4: 244
Right 1021279102 7:18694827-18694849 TTCAAAGGGACAATATCCTTGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1021279096_1021279099 -8 Left 1021279096 7:18694797-18694819 CCCTCCAGTTTATGCAAATGGAA 0: 1
1: 0
2: 0
3: 26
4: 244
Right 1021279099 7:18694812-18694834 AAATGGAACTTTTTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279096 Original CRISPR TTCCATTTGCATAAACTGGA GGG (reversed) Intronic
900697204 1:4019831-4019853 TGCCATTTACAGAGACTGGAAGG - Intergenic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
902638122 1:17748300-17748322 TGCCATTTACATCATCTGGAAGG - Intergenic
904894406 1:33803367-33803389 TGTCATTTGGATATACTGGATGG - Intronic
906798990 1:48719780-48719802 TTCCTCTTCCATAAAATGGAAGG - Intronic
909363733 1:74795937-74795959 TTACTTTTGCATAAAATGTAGGG + Intergenic
909533083 1:76702698-76702720 TTCCATTTGAGTCAGCTGGATGG - Intergenic
910246923 1:85148890-85148912 TACCATTTCCATAAAAGGGAGGG + Intergenic
910541935 1:88369403-88369425 TTCCATCTGCATAAATGTGAAGG + Intergenic
911006112 1:93226381-93226403 TTGCATTTGAATCAATTGGAAGG + Exonic
913265809 1:117042907-117042929 TTCCATTTTCATGGATTGGAAGG + Intergenic
915358647 1:155272366-155272388 TTCCAATTCCATTAACTGGAAGG - Intronic
916477557 1:165184474-165184496 TTCCATTTGCATACACTTAAGGG + Intergenic
918005368 1:180536844-180536866 TTCCATTTGCTAGAAGTGGACGG - Intergenic
919107917 1:193177068-193177090 TACCATTTTCACACACTGGAGGG - Intronic
920911718 1:210224520-210224542 TTCCATATGTATAAAGTGAAGGG + Intergenic
921100777 1:211927363-211927385 TTCCATTTGTATAAATTGTATGG - Intergenic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
923239333 1:232065936-232065958 TACGATTTTCATAAAGTGGAAGG + Intergenic
1063265850 10:4449882-4449904 TTCCATTTTCAGAGGCTGGATGG + Intergenic
1066202786 10:33158403-33158425 TGGCATTTGCAGCAACTGGATGG + Intergenic
1066693839 10:38060680-38060702 AACCATTGGCATAAACAGGATGG + Intronic
1068066419 10:52138088-52138110 TTCCATTTTCATAACCAGTATGG - Intronic
1069253888 10:66308123-66308145 TTTCATTTGCAAAAAATGCAGGG - Intronic
1069295663 10:66841427-66841449 ATCCATTTGAATGAATTGGAAGG - Intronic
1070072909 10:73107001-73107023 TCCCATGTTCATAAATTGGAAGG - Intergenic
1070236729 10:74635441-74635463 TTCCATTTGTATAAAGTCAATGG + Intronic
1070390205 10:75963534-75963556 TTTCTTTTGCATAGACTGCATGG - Intronic
1070541363 10:77417734-77417756 TTCCATTTGCTGAACTTGGATGG + Intronic
1071058543 10:81541366-81541388 TGGCATTTACATAACCTGGATGG + Intergenic
1071088143 10:81888078-81888100 TTCCATGTACAGAGACTGGATGG + Intronic
1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG + Intergenic
1072745138 10:97934507-97934529 CTGCAGTTGCATAAACGGGAGGG - Intronic
1075215596 10:120530186-120530208 GTCCATTTGTAAAAACTGAATGG - Intronic
1075632486 10:124009499-124009521 TTACATCTGAAGAAACTGGAGGG + Exonic
1076255032 10:129016089-129016111 TTCCATAGACATAAACTTGAAGG + Intergenic
1076258881 10:129050329-129050351 TTCCATGTGCATAAAATACATGG + Intergenic
1079067404 11:17307510-17307532 TTCCTTTTGCATAAAAAGAAAGG - Intronic
1079340822 11:19610667-19610689 TTCCATTTCCAGCAAATGGATGG + Intronic
1079506009 11:21153043-21153065 TGCCATCTGCATAAACAGGAAGG - Intronic
1082107994 11:48241882-48241904 TTCCATTGTCACAAACTGGCTGG - Intergenic
1085125752 11:74001097-74001119 ATCCATTTGGACAAAATGGAAGG - Exonic
1085591316 11:77763958-77763980 TTACATTTGAATCAACTAGATGG + Intronic
1088155854 11:106802408-106802430 TTTCATTTGCATCAATGGGACGG + Intronic
1088320343 11:108549063-108549085 TCTCATTGGCATAAAGTGGATGG - Intronic
1088912679 11:114203858-114203880 CTCCATTTTCAGAAACAGGAAGG + Intronic
1088969174 11:114756754-114756776 TTCCATATTCATAAAGTGAAGGG + Intergenic
1089193577 11:116676519-116676541 TTCCATGTTCATAGATTGGAAGG + Intergenic
1089540308 11:119185841-119185863 TTCCATTGGCATAAACTAAAAGG - Intronic
1089781990 11:120879756-120879778 TCGCATGTGCAAAAACTGGAGGG - Intronic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1091118908 11:133040462-133040484 TTCCATTTGGAAGGACTGGAGGG - Intronic
1091448017 12:555309-555331 TTCCATTTGCATAAGATGTCCGG - Intronic
1092575314 12:9776316-9776338 TTACATTTTCATAAACATGAGGG + Intergenic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1094347497 12:29486878-29486900 TTCCATTTTGATCACCTGGAAGG - Intronic
1094592086 12:31831344-31831366 TGGCATTTGCAGCAACTGGATGG + Intergenic
1097371336 12:58785232-58785254 TTCCATTTTCTTAAGGTGGAAGG - Intronic
1097373124 12:58808403-58808425 TTCCTTCAGCATAAACTAGATGG + Intronic
1098537823 12:71615260-71615282 TTCCCTTTACATAAACGAGATGG + Exonic
1098688292 12:73453443-73453465 TTCCATATGCATTAGCTGAATGG - Intergenic
1099781507 12:87201663-87201685 TTCCTTTTACAGAAATTGGAGGG - Intergenic
1100326781 12:93547456-93547478 TACCTTTTGAATAAACTGCAGGG - Intergenic
1102774689 12:115508258-115508280 TTCTATTTACCTGAACTGGAGGG + Intergenic
1104659832 12:130603153-130603175 TTACATTTGCATATCCTGGATGG - Intronic
1105370573 13:19798413-19798435 TTCCATGTTCATAGATTGGAAGG + Intergenic
1105867724 13:24475385-24475407 TTGCAGTTGCATGAACTGAAGGG - Intronic
1106172325 13:27298582-27298604 TTCCTTTTTAATAAAGTGGAAGG + Intergenic
1107201844 13:37729864-37729886 TTCCATCTTCCAAAACTGGAAGG - Intronic
1107327342 13:39258799-39258821 TTCCATTTGCACAATGTGGGTGG - Intergenic
1108320829 13:49288777-49288799 TTCCATTTGCATGGAGTGGAAGG - Intronic
1109555944 13:63975968-63975990 TGCCATCTGCATTAACTGGCTGG + Intergenic
1110495281 13:76160941-76160963 TACCACTTGCTTAAGCTGGAGGG + Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1111546821 13:89748899-89748921 TTCCCTTTCCATACACTGCAGGG - Intergenic
1112523910 13:100124654-100124676 TTCCAGCTGAACAAACTGGAGGG + Intronic
1114874487 14:26698793-26698815 CTCCATTTGCCTACACTTGAAGG - Intergenic
1115551124 14:34506011-34506033 TTCCATTGAGATAAGCTGGAAGG + Intergenic
1115934434 14:38535849-38535871 TCCAATTTGCATAAACTACAAGG - Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1117080447 14:52146482-52146504 TTCCATTTGTATAAGGTGTAAGG + Intergenic
1117493689 14:56277876-56277898 CTCCATTTGCCTGAATTGGAAGG - Intronic
1118581195 14:67300105-67300127 TTCCATATGTATAAACAGGACGG - Intronic
1120614798 14:86690154-86690176 TTCCATTACCATCACCTGGAGGG - Intergenic
1120631039 14:86890415-86890437 TTCCATTTGCTTTACCTGAAAGG - Intergenic
1120667586 14:87324965-87324987 TTCCATTTGCATGAAATGTTTGG - Intergenic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1127022653 15:54766607-54766629 TTACATTTGCAAAAACTTAAAGG + Intergenic
1128399498 15:67263472-67263494 TTTAATCTGCATAAACTTGAGGG - Intronic
1128487011 15:68102560-68102582 TACCATGTTCATATACTGGAAGG - Intronic
1130944032 15:88537505-88537527 TTTCATTTACAAAAACTGGGAGG - Intronic
1133355210 16:5131125-5131147 ACCCATTTGCATGAGCTGGAGGG - Intergenic
1133891937 16:9887399-9887421 TTCCATTTACATAAAGTTCAAGG - Intronic
1137816805 16:51405799-51405821 TTCCATTTTCTCAAACTGGTGGG + Intergenic
1138963364 16:62053728-62053750 GTCCATATGCATAAACTGCAAGG - Intergenic
1140628424 16:76822591-76822613 TTCCATCTGAATCACCTGGAAGG + Intergenic
1143235855 17:5399281-5399303 TGCCATTTACATAATCTAGATGG - Intronic
1144251595 17:13422094-13422116 TTCCATTTGTGAAAAATGGAAGG - Intergenic
1144321392 17:14124397-14124419 TTCCATTCGCATAAAGTTAAGGG + Intronic
1146218993 17:31002191-31002213 TTCCTTATGCATCAACAGGAAGG - Intergenic
1146741761 17:35291042-35291064 TTCCATGTTCATGAATTGGAAGG + Intergenic
1147246639 17:39125441-39125463 TTCCATTTCCATGAACTGTTAGG - Intronic
1148389113 17:47257632-47257654 CTCCGTTTGGATAATCTGGAGGG + Intronic
1148467869 17:47875530-47875552 ATCCATTTGCATATACTTGTTGG + Intergenic
1148496454 17:48055894-48055916 TTTCATTTGCATAAAGGGGTGGG - Intronic
1149721982 17:58854039-58854061 TTCCATGTTCATGAACTGAAGGG - Intronic
1150657405 17:67048936-67048958 CTCCCTTTACATAAACTTGATGG - Intronic
1151114556 17:71720537-71720559 TTCCAGTTACCTAAAGTGGAAGG - Intergenic
1151201798 17:72473992-72474014 TGGCATTTGCAGCAACTGGATGG + Intergenic
1151216623 17:72581534-72581556 TTCCATTTGCAGAATCTTGGTGG + Intergenic
1151523398 17:74647245-74647267 ATCCAGATGCATAAACTGTATGG + Intergenic
1154398527 18:14012043-14012065 TTCCATGTGCATGGATTGGAAGG - Intergenic
1156621863 18:38862189-38862211 GTCTATATTCATAAACTGGAAGG + Intergenic
1156703756 18:39855515-39855537 TTCCATTTGCATTCACAAGAGGG - Intergenic
1156874306 18:41988793-41988815 TCCTATATACATAAACTGGAAGG + Intronic
1157131093 18:45008073-45008095 TTGCATTAGCATATACTGGAGGG - Intronic
1157424490 18:47573062-47573084 TTTCTGTTGCTTAAACTGGATGG - Intergenic
1158477399 18:57792515-57792537 TTCCATTTACATAAAATGCCCGG + Intronic
1159078558 18:63709182-63709204 TTCTATTTTCATAAACATGATGG + Intronic
1159332179 18:67010265-67010287 TTACATTTTTAGAAACTGGAAGG - Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1162579517 19:11520093-11520115 TTCCATTTGTATGAAATGGCCGG - Intronic
1166113835 19:40640689-40640711 GTCCTGTTGCTTAAACTGGATGG - Intergenic
925280526 2:2681457-2681479 TGCCATTTGAATACACTGAATGG + Intergenic
930249251 2:49017240-49017262 TGCCATTTGCATTAATGGGACGG - Intronic
931256071 2:60574040-60574062 TTCTATTTACATACACAGGATGG + Intergenic
931833743 2:66077883-66077905 TTTAATTTGCATAATCTGTATGG + Intergenic
933891368 2:86774072-86774094 TTCCGTTAGCATAGAGTGGAAGG + Exonic
934636694 2:95995896-95995918 TTCCAAAAGCATAAACTGAAAGG + Intergenic
934796956 2:97109528-97109550 TTCCAAAAGCATAAACTGAAAGG - Intergenic
934836458 2:97593899-97593921 TTCCAAAAGCATAAACTGAAAGG + Intergenic
935315009 2:101824086-101824108 TTCCATTTGCTTGAATTGTAAGG + Intronic
935816924 2:106854601-106854623 TGCCATGTGTATAAACTTGATGG + Intronic
936545344 2:113387561-113387583 TTCCAAAAGCATAAACTGAAAGG - Intergenic
937544159 2:122995587-122995609 TTCCAGTTCCTTAAGCTGGATGG - Intergenic
938661136 2:133488513-133488535 CTCCATATGCCTAGACTGGATGG - Intronic
939705157 2:145443602-145443624 TTTCATTGACATAAAATGGATGG - Intergenic
941502946 2:166303781-166303803 TTCCATTTGCTTATACAGGAAGG - Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
945874360 2:215263115-215263137 TTCCATTTGCATTTACTGTAGGG - Intergenic
948978896 2:241482551-241482573 ATGCATTTGCGTTAACTGGATGG - Intronic
1169832926 20:9844231-9844253 TTCCATTTTCATACTCTGTAAGG - Intergenic
1173587747 20:44196507-44196529 TTCAATTTGAATAAACTAGCTGG - Exonic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1177279469 21:18961983-18962005 TTCCACTTCCATAAACTGCAAGG - Intergenic
1177908444 21:27000022-27000044 TTCAATTTGTATAAACTGTTAGG - Intergenic
1177964286 21:27707744-27707766 TTCCATATTCATTAATTGGAAGG - Intergenic
1179319908 21:40280709-40280731 GTCCATTTGCATAAAAACGAAGG - Intronic
1182005828 22:26958784-26958806 TTCCATTTGTAAAATCAGGAGGG + Intergenic
1182178569 22:28319759-28319781 TTCCATTTGAATAATTTGAAGGG + Intronic
1182580438 22:31305991-31306013 TTCCATTTACATAAAATGTCTGG - Intergenic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
950350734 3:12349078-12349100 TTTCATTGGCTTAAACTTGAAGG - Intronic
951091199 3:18575900-18575922 TTCTATATGCAAAAACTGCATGG + Intergenic
956178496 3:66496798-66496820 CTTAATTTGCATAAACAGGATGG + Intronic
956325481 3:68047910-68047932 ATCCATTCGCATAATCTGGAAGG - Intronic
957059054 3:75466771-75466793 ACCCATTTGCATGAGCTGGAGGG - Intergenic
957170597 3:76732079-76732101 TGCCATTAGTAGAAACTGGAAGG + Intronic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
958732476 3:97973627-97973649 TTCCAGTTGGAAAAACTCGAGGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
959730823 3:109599750-109599772 TTACATTTGAATATACTGCATGG - Intergenic
959926798 3:111931142-111931164 TTCCTTTTATATAAACTGGCAGG - Intronic
960206986 3:114914193-114914215 TTCCATGTTCATGAATTGGAAGG - Intronic
960804585 3:121571526-121571548 CTCCATGTGCATAAATGGGAAGG + Intronic
961294395 3:125872964-125872986 ATCCATTTGCATGAGCTGGAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964707973 3:159640917-159640939 TTAAATTTGCATAATCTGGCAGG + Intronic
966966798 3:185002753-185002775 TGGCATTTGCACAATCTGGATGG - Intronic
968378998 4:72784-72806 TTCCTTTTGTATAAAATGAAGGG + Intronic
968986180 4:3875723-3875745 TAGCATTTGCATAGAATGGAGGG + Intergenic
969002967 4:3996958-3996980 ACCCATTTGCATGAGCTGGAGGG - Intergenic
969810967 4:9647858-9647880 ACCCATTTGCATGAGCTGGAGGG + Intergenic
970795959 4:19913900-19913922 TTCCATTTGAAAATGCTGGAGGG + Intergenic
971143421 4:23949609-23949631 ATCCATTTGCTTAAAATGGTTGG - Intergenic
971413689 4:26402421-26402443 TTCCTTTTCCATACCCTGGAAGG + Intronic
974516160 4:62914560-62914582 TTCCATTTGAATGGATTGGAGGG - Intergenic
974892935 4:67903351-67903373 TTCCATGTTCATAGATTGGAAGG - Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
976540312 4:86266483-86266505 TTCCATTTGTACAAACAGGCTGG + Intronic
976895226 4:90101399-90101421 TTCCATTTGCATTGACAGGTTGG - Intergenic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
982238786 4:153277814-153277836 TTCCCTTGGCATAAAATGCATGG - Intronic
983912684 4:173257723-173257745 TTCCATTTGATTAAAATGGCAGG - Intronic
984150357 4:176122511-176122533 TTCCTTTTGCATATACATGAGGG + Intronic
984268901 4:177526650-177526672 TCCCACTGGCATAAGCTGGAAGG + Intergenic
984269189 4:177529964-177529986 TTCCACTGGCATAACTTGGAAGG + Intergenic
985516603 5:348586-348608 TTCCATTTGCACAAAATGCCAGG - Intronic
985766542 5:1782632-1782654 TTTCATTTTCCTAAACGGGAGGG + Intergenic
986075102 5:4328114-4328136 TTCCATTTGGAAAAACTGTAAGG + Intergenic
988129785 5:27088824-27088846 GTACATTTTCATAAGCTGGAAGG + Intronic
988189206 5:27906182-27906204 TGCCATTTGCATCAACTTTAAGG - Intergenic
988955801 5:36317244-36317266 TTCCATGTTCATGAACTGGAAGG - Intergenic
989665827 5:43852930-43852952 TTGCAATTGCATAAAATTGAGGG - Intergenic
989787908 5:45353232-45353254 TTCCACTTGCTTATACTGTAAGG + Exonic
992460528 5:76955486-76955508 TTTCATTTGTATATATTGGATGG - Intronic
993706406 5:91176691-91176713 TTACACTTGCATAAACTAGAAGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994338400 5:98597105-98597127 ATTCATCTGGATAAACTGGATGG + Intergenic
996418033 5:123230845-123230867 TTCACTTTCCCTAAACTGGAAGG - Intergenic
997324842 5:133011703-133011725 TACCATGTTCATAGACTGGAAGG + Intronic
998063416 5:139137050-139137072 TTACATTTCCACAAAGTGGAAGG - Intronic
1002003312 5:176211653-176211675 TTCCAGTTTCTTAAAGTGGAAGG + Intergenic
1002881152 6:1253907-1253929 ATCCATTTGCACACACTTGAAGG + Intergenic
1003469413 6:6415455-6415477 TTCCATTTCCAAAAACAGAATGG + Intergenic
1003628272 6:7763704-7763726 TGCCATTTCCTTAAAATGGAGGG - Intronic
1004572137 6:16857025-16857047 TATCATTTGCACAGACTGGATGG + Intergenic
1004761946 6:18677098-18677120 TTTCCTTTGCATAAAATGGTGGG + Intergenic
1004859314 6:19784945-19784967 TACCATGTTCACAAACTGGAAGG + Intergenic
1007382213 6:41497842-41497864 TTCCTTTTGCTTAAACTAGTTGG + Intergenic
1008891750 6:56501222-56501244 TTTCTGTAGCATAAACTGGAGGG - Exonic
1011140942 6:84155754-84155776 TCCCATGTGCATAGACTGGAAGG + Intronic
1011460116 6:87594018-87594040 TTCCATTTTCATAAACTTAAAGG - Intronic
1012738794 6:102986608-102986630 TTCCATTCTCATAAACATGATGG + Intergenic
1015815273 6:137204415-137204437 CTCCATTTACAAAAACTGAAGGG + Exonic
1017170895 6:151453054-151453076 ATCCATTTGCATAAATCGAATGG + Intronic
1018157727 6:161003896-161003918 TTCCATTTTTATAAATTAGATGG + Intronic
1020321916 7:6945084-6945106 ATCCATTTGCATGAGCTGGAGGG - Intergenic
1020836658 7:13161593-13161615 TTCCATTTGCATATTCAGCATGG + Intergenic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1021563598 7:21993726-21993748 TTCAATTTTCATAATTTGGAGGG - Intergenic
1021569275 7:22048197-22048219 TGCCATTTCCATAAATGGGAAGG + Intergenic
1024411184 7:49044043-49044065 TTCCATATTCATGGACTGGAAGG + Intergenic
1025068302 7:55876106-55876128 TTTCATTTACATTAAATGGATGG - Intergenic
1028713138 7:93933903-93933925 TTCCATTAGGATAAACTAGAAGG + Intergenic
1031724031 7:125214436-125214458 TCCCATTTGCATCAAATGTATGG + Intergenic
1032273270 7:130431252-130431274 TTTCAATTACATAAACAGGATGG + Intronic
1032988937 7:137369168-137369190 TACCATTAGTATAAACAGGACGG + Intergenic
1035420181 7:158723451-158723473 TTCCATTTCCATAACCATGAGGG - Intergenic
1037540353 8:19864950-19864972 ATCCATTTGCATAAACATAAAGG + Intergenic
1038598237 8:28910140-28910162 TTCCATTTACATAAAATGTCTGG - Intronic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1038951113 8:32415627-32415649 AGCCATTTCCATAAACTGTATGG - Intronic
1040510954 8:48094164-48094186 TTCCATGTTCATGAATTGGAAGG - Intergenic
1041603652 8:59754008-59754030 CTCCATGTGCATACACTGTAGGG + Intergenic
1042716376 8:71777486-71777508 TTTCATTTGTATAAACTTAAGGG - Intergenic
1045448793 8:102297658-102297680 TTCCAGTTGAAGAAAATGGATGG - Intronic
1046025777 8:108721875-108721897 TTCCATTTGTATAAACTTCTAGG - Intronic
1047816605 8:128471116-128471138 TTCCATTAGCTTAAAGAGGAAGG - Intergenic
1048234520 8:132676422-132676444 CTCCATTTGCAGAAAAAGGAGGG + Intergenic
1048835444 8:138514547-138514569 TGCCATTTGCCTAAAGAGGAGGG - Intergenic
1052212661 9:25925403-25925425 TCCCATTTTCATGAACTGGAAGG + Intergenic
1052412830 9:28144877-28144899 TCCCAGTTACAAAAACTGGATGG + Intronic
1053563791 9:39225664-39225686 TTACATTTTCATACACAGGAAGG - Intronic
1053829575 9:42063574-42063596 TTACATTTTCATACACAGGAAGG - Intronic
1054133356 9:61393403-61393425 TTACATTTTCATACACAGGAAGG + Intergenic
1054357329 9:64073378-64073400 TTTCAGTTGCATCAACAGGATGG + Intergenic
1054600983 9:67123880-67123902 TTACATTTTCATACACAGGAAGG + Intergenic
1054734269 9:68734680-68734702 TCCCTTTTGTATAGACTGGAGGG - Intronic
1055218223 9:73894083-73894105 TTCCATTTGTAGAATCTAGATGG - Intergenic
1055560990 9:77521555-77521577 TTCCATTCTCAGAAAGTGGAAGG - Intronic
1055691845 9:78840654-78840676 TTTCATTTTCATTAAGTGGATGG - Intergenic
1058044849 9:100346776-100346798 CTCCATTTTTATCAACTGGAAGG - Exonic
1058714110 9:107708036-107708058 CTTCATTTGCAAAAACTGGTAGG - Intergenic
1059225433 9:112668532-112668554 TTTCATTTGCTTGCACTGGAAGG + Intronic
1059727935 9:117027601-117027623 TCCCATTTGAGGAAACTGGATGG - Intronic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1190271511 X:48867447-48867469 TTCCATGTGCATAACAGGGATGG - Intergenic
1191148529 X:57194886-57194908 TGGCATTTGCAGCAACTGGATGG - Intergenic
1193242306 X:79185382-79185404 TTTCCTTTCCATAAACTGTAAGG - Intergenic
1193667536 X:84340544-84340566 ATACATTTTCATAAACTGGAAGG + Intronic
1195651165 X:107286648-107286670 TTCCACATGCAGAAACAGGAAGG + Intergenic
1195791292 X:108590532-108590554 TTTCATTTTCAAAAACTGGTTGG - Intronic
1196247387 X:113415699-113415721 TTCCATTTGAGAAAATTGGAGGG + Intergenic
1196538247 X:116873298-116873320 TTCATTTTGAATAAACTGTAAGG - Intergenic
1198247945 X:134849361-134849383 TTCTAGTTGCATAAAATGAAAGG - Intronic
1199043277 X:143139486-143139508 TTGCATCAGCATAACCTGGATGG + Intergenic
1200344986 X:155439278-155439300 TTACATTTGCAAAGACTGCAGGG - Intergenic
1200523007 Y:4234855-4234877 TACCATTTGATTAAACTGCAGGG + Intergenic