ID: 1021279780

View in Genome Browser
Species Human (GRCh38)
Location 7:18703732-18703754
Sequence GGTTATTTCTGGAAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279780_1021279794 10 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC No data
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279780_1021279790 4 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC No data
Right 1021279790 7:18703759-18703781 ATCCCCATCCCTGTCCCCCAGGG 0: 1
1: 0
2: 6
3: 52
4: 415
1021279780_1021279789 3 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC No data
Right 1021279789 7:18703758-18703780 AATCCCCATCCCTGTCCCCCAGG No data
1021279780_1021279795 11 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC No data
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279780 Original CRISPR GGTTATTTCTGGAAGGAGAG GGG (reversed) Intronic