ID: 1021279782

View in Genome Browser
Species Human (GRCh38)
Location 7:18703734-18703756
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279782_1021279790 2 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279790 7:18703759-18703781 ATCCCCATCCCTGTCCCCCAGGG 0: 1
1: 0
2: 6
3: 52
4: 415
1021279782_1021279795 9 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279782_1021279794 8 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279782_1021279789 1 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279789 7:18703758-18703780 AATCCCCATCCCTGTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279782 Original CRISPR GGGGTTATTTCTGGAAGGAG AGG (reversed) Intronic