ID: 1021279783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:18703739-18703761 |
| Sequence | GATTGGGGGTTATTTCTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 190 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 19, 4: 170} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021279783_1021279790 | -3 | Left | 1021279783 | 7:18703739-18703761 | CCTTCCAGAAATAACCCCCAATC | 0: 1 1: 0 2: 0 3: 19 4: 170 |
||
| Right | 1021279790 | 7:18703759-18703781 | ATCCCCATCCCTGTCCCCCAGGG | 0: 1 1: 0 2: 6 3: 52 4: 415 |
||||
| 1021279783_1021279795 | 4 | Left | 1021279783 | 7:18703739-18703761 | CCTTCCAGAAATAACCCCCAATC | 0: 1 1: 0 2: 0 3: 19 4: 170 |
||
| Right | 1021279795 | 7:18703766-18703788 | TCCCTGTCCCCCAGGGCCCTGGG | No data | ||||
| 1021279783_1021279789 | -4 | Left | 1021279783 | 7:18703739-18703761 | CCTTCCAGAAATAACCCCCAATC | 0: 1 1: 0 2: 0 3: 19 4: 170 |
||
| Right | 1021279789 | 7:18703758-18703780 | AATCCCCATCCCTGTCCCCCAGG | No data | ||||
| 1021279783_1021279794 | 3 | Left | 1021279783 | 7:18703739-18703761 | CCTTCCAGAAATAACCCCCAATC | 0: 1 1: 0 2: 0 3: 19 4: 170 |
||
| Right | 1021279794 | 7:18703765-18703787 | ATCCCTGTCCCCCAGGGCCCTGG | 0: 1 1: 0 2: 11 3: 53 4: 520 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021279783 | Original CRISPR | GATTGGGGGTTATTTCTGGA AGG (reversed) | Intronic | ||