ID: 1021279785

View in Genome Browser
Species Human (GRCh38)
Location 7:18703753-18703775
Sequence GGGACAGGGATGGGGATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1099
Summary {0: 1, 1: 1, 2: 11, 3: 132, 4: 954}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279785_1021279804 20 Left 1021279785 7:18703753-18703775 CCCCCAATCCCCATCCCTGTCCC 0: 1
1: 1
2: 11
3: 132
4: 954
Right 1021279804 7:18703796-18703818 ACATTCCTACCTCTTCCTCCAGG No data
1021279785_1021279795 -10 Left 1021279785 7:18703753-18703775 CCCCCAATCCCCATCCCTGTCCC 0: 1
1: 1
2: 11
3: 132
4: 954
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279785 Original CRISPR GGGACAGGGATGGGGATTGG GGG (reversed) Intronic