ID: 1021279794

View in Genome Browser
Species Human (GRCh38)
Location 7:18703765-18703787
Sequence ATCCCTGTCCCCCAGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 11, 3: 53, 4: 520}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279781_1021279794 9 Left 1021279781 7:18703733-18703755 CCCTCTCCTTCCAGAAATAACCC 0: 1
1: 2
2: 2
3: 31
4: 279
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279779_1021279794 11 Left 1021279779 7:18703731-18703753 CCCCCTCTCCTTCCAGAAATAAC 0: 1
1: 0
2: 3
3: 36
4: 358
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279782_1021279794 8 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279780_1021279794 10 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC No data
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279784_1021279794 -1 Left 1021279784 7:18703743-18703765 CCAGAAATAACCCCCAATCCCCA No data
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520
1021279783_1021279794 3 Left 1021279783 7:18703739-18703761 CCTTCCAGAAATAACCCCCAATC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1021279794 7:18703765-18703787 ATCCCTGTCCCCCAGGGCCCTGG 0: 1
1: 0
2: 11
3: 53
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279794 Original CRISPR ATCCCTGTCCCCCAGGGCCC TGG Intronic