ID: 1021279795

View in Genome Browser
Species Human (GRCh38)
Location 7:18703766-18703788
Sequence TCCCTGTCCCCCAGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021279782_1021279795 9 Left 1021279782 7:18703734-18703756 CCTCTCCTTCCAGAAATAACCCC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279781_1021279795 10 Left 1021279781 7:18703733-18703755 CCCTCTCCTTCCAGAAATAACCC 0: 1
1: 2
2: 2
3: 31
4: 279
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279780_1021279795 11 Left 1021279780 7:18703732-18703754 CCCCTCTCCTTCCAGAAATAACC 0: 1
1: 1
2: 2
3: 36
4: 333
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279783_1021279795 4 Left 1021279783 7:18703739-18703761 CCTTCCAGAAATAACCCCCAATC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279785_1021279795 -10 Left 1021279785 7:18703753-18703775 CCCCCAATCCCCATCCCTGTCCC 0: 1
1: 1
2: 11
3: 132
4: 954
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279779_1021279795 12 Left 1021279779 7:18703731-18703753 CCCCCTCTCCTTCCAGAAATAAC 0: 1
1: 0
2: 3
3: 36
4: 358
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data
1021279784_1021279795 0 Left 1021279784 7:18703743-18703765 CCAGAAATAACCCCCAATCCCCA 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021279795 Original CRISPR TCCCTGTCCCCCAGGGCCCT GGG Intronic
No off target data available for this crispr