ID: 1021285764

View in Genome Browser
Species Human (GRCh38)
Location 7:18779247-18779269
Sequence GCTCCATTTCAAGACTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021285759_1021285764 2 Left 1021285759 7:18779222-18779244 CCATTGTTATCATAAATCCATCC 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG No data
1021285758_1021285764 3 Left 1021285758 7:18779221-18779243 CCCATTGTTATCATAAATCCATC 0: 1
1: 1
2: 1
3: 10
4: 202
Right 1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG No data
1021285756_1021285764 7 Left 1021285756 7:18779217-18779239 CCCACCCATTGTTATCATAAATC 0: 1
1: 0
2: 2
3: 8
4: 115
Right 1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG No data
1021285757_1021285764 6 Left 1021285757 7:18779218-18779240 CCACCCATTGTTATCATAAATCC 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021285764 Original CRISPR GCTCCATTTCAAGACTCTCA GGG Intronic
No off target data available for this crispr