ID: 1021286512

View in Genome Browser
Species Human (GRCh38)
Location 7:18787608-18787630
Sequence ATCTGAAGGTAGGAATATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021286512 Original CRISPR ATCTGAAGGTAGGAATATTT AGG Intronic
900621369 1:3588972-3588994 ACAGGAAGGCAGGAATATTTGGG - Intronic
903829649 1:26166969-26166991 ATGTGAAGGTGTGAACATTTTGG - Intergenic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
904924586 1:34037433-34037455 CACTGAAGATACGAATATTTCGG - Intronic
904947788 1:34212297-34212319 CTCTGAGGGTAGGGATAATTGGG - Exonic
907679399 1:56549772-56549794 ATCTGAAGGTCTGCAGATTTTGG - Intronic
907759204 1:57341258-57341280 ATTTGAAGGTAGGAAGAATCAGG - Intronic
909524639 1:76608975-76608997 TTATGAATGTAGGATTATTTTGG + Intronic
909958621 1:81807361-81807383 ATTTGAAGAGATGAATATTTGGG - Intronic
912604018 1:110969412-110969434 ACCAGGAGGTAGGAATAATTGGG + Intergenic
916870555 1:168910113-168910135 ATCTGGAGGCATGAATTTTTAGG + Intergenic
918071547 1:181137047-181137069 ATCTGAAGGGAGGTGTATTTTGG - Intergenic
919522164 1:198601660-198601682 CTCAGAAGATAGGAATATGTGGG - Intergenic
921696051 1:218212088-218212110 TTCTTAAGGTAGGTAGATTTGGG - Intergenic
921719008 1:218449925-218449947 ATCTCAACGTAAGAATTTTTCGG + Intergenic
923792204 1:237121354-237121376 ATCTGAATGGAAGAATTTTTTGG - Intronic
924786194 1:247202246-247202268 ACCTGAAGGCAGGAAATTTTTGG - Intergenic
1064047928 10:12035001-12035023 ATGGGAAGATTGGAATATTTTGG - Intronic
1066355687 10:34681469-34681491 ATATGTAGGTGGGAATATTCAGG - Intronic
1066706548 10:38185670-38185692 AGCTGGAGGTAGGAACAGTTAGG + Intergenic
1070274310 10:74990288-74990310 AACTGAAAGGAGGAAAATTTAGG + Intronic
1071111146 10:82158330-82158352 ATCTAAATGTTTGAATATTTTGG + Intronic
1073882142 10:107995413-107995435 ATCAGAAGGTGGGGACATTTGGG + Intergenic
1074102177 10:110362443-110362465 ATCCAAGGGTAAGAATATTTTGG - Intergenic
1076012048 10:126996775-126996797 AGATGAAGATGGGAATATTTTGG + Exonic
1078876929 11:15408567-15408589 AACTGAAGGTAAGATCATTTTGG + Intergenic
1080939273 11:36897105-36897127 GTCAGAAGGTAGGAATATTCGGG - Intergenic
1085877978 11:80431665-80431687 ATCTAAAGGTAGGAATTTTCAGG - Intergenic
1086048840 11:82565186-82565208 ATTTGAAGGTAGGAAGGTATGGG - Intergenic
1086193124 11:84104105-84104127 ATCTGAATGTGGGGATAGTTTGG + Intronic
1087725069 11:101707392-101707414 ATCTGAAGGAAGAAATTTCTAGG + Intronic
1089328576 11:117674335-117674357 TACTGAAGGTAGGAAGTTTTGGG + Intronic
1090685783 11:129117451-129117473 ACCTGAGTGTAGGAATATTGAGG - Intronic
1091009229 11:131983130-131983152 ATCTGAAAGTAGGAAAAGATTGG + Intronic
1091325966 11:134687969-134687991 ATCTGGAGGAAGGAAGATATTGG + Intergenic
1092944413 12:13439675-13439697 CTCAGAAGGTAGGAAGATGTGGG - Intergenic
1095279155 12:40329561-40329583 ATCTAGAAGTAGAAATATTTTGG - Intronic
1095728391 12:45476923-45476945 ATCTGGAGATAGAAAGATTTGGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1098374485 12:69799416-69799438 ATCTGTAGGGAAGAATACTTGGG + Intronic
1098784670 12:74737003-74737025 ATCTGAAGGTAGAAAGATCCCGG + Intergenic
1098915683 12:76254639-76254661 ATGGGAAGGAAGGAATGTTTGGG - Intergenic
1100963992 12:99992479-99992501 ATCTGCAGAAAGGAATATATAGG + Intergenic
1104353286 12:128063541-128063563 TCTTGAAGGTAGGAATATCTAGG - Intergenic
1105912430 13:24882743-24882765 AACTGAACATAGTAATATTTTGG + Intronic
1107623227 13:42255538-42255560 ATGTGAAGGCAGAAAAATTTGGG + Intronic
1108022655 13:46144427-46144449 TTGTACAGGTAGGAATATTTGGG - Exonic
1109189355 13:59306889-59306911 ATCTGAAGGTTAGCATTTTTGGG + Intergenic
1109319184 13:60789040-60789062 AACTAAAGGTAGAAACATTTGGG - Intergenic
1111544609 13:89715398-89715420 TTCTGAAGGTGGGAGCATTTTGG - Intergenic
1112682208 13:101779651-101779673 ATCTGAAGGTATAAATATTTTGG + Intronic
1112689762 13:101878768-101878790 ATCTGAAGGTATGTGCATTTAGG - Intronic
1113529821 13:111014807-111014829 ATCTAAAGGTAGAATTTTTTAGG + Intergenic
1114402952 14:22426625-22426647 ATCAGAAGGAGGGAATATGTGGG - Intergenic
1116220697 14:42083880-42083902 ATCTGAAGGTACAAATATCACGG - Intergenic
1116343121 14:43752448-43752470 ATGTGAAGGGAGGAATGCTTGGG - Intergenic
1116380964 14:44267454-44267476 ATCAGAAGGTGGGAATTATTGGG - Intergenic
1116723056 14:48525537-48525559 TTCTGAAAGTAGGAAAATTAAGG + Intergenic
1120116233 14:80620754-80620776 ATCTGAGGGTAGAAATATTGAGG + Intronic
1122444527 14:101759946-101759968 ATCTAAAGGGAGGAATGTTGTGG - Intergenic
1125435201 15:39636874-39636896 ATCCTTAGGTAAGAATATTTAGG + Intronic
1128026092 15:64437949-64437971 ATCTGATGATTGGAATGTTTAGG + Intronic
1128290051 15:66471493-66471515 ATCTGAAGTTAGGCAGATCTGGG - Intronic
1130671376 15:85915869-85915891 ATCTGAAGCTTGTAAGATTTGGG + Intergenic
1130741386 15:86603990-86604012 ATCTTAAAGCAGAAATATTTGGG - Intronic
1132249260 15:100322094-100322116 ACCTGAAGGTTGGAAGATGTGGG + Intronic
1134432241 16:14221315-14221337 ATATGAAAGTAAGTATATTTAGG - Intronic
1135957908 16:26971725-26971747 CTATGAAGGCCGGAATATTTTGG + Intergenic
1140640405 16:76965216-76965238 TTCTGAAGGAAGAGATATTTAGG + Intergenic
1144335633 17:14266715-14266737 GTATGAAGGTAGGAGTAGTTGGG - Intergenic
1146530772 17:33606048-33606070 TTGTGCAGGAAGGAATATTTAGG + Intronic
1148494716 17:48046628-48046650 ATAAGAAAGGAGGAATATTTAGG - Intergenic
1149164831 17:53738660-53738682 ATCTTGAGGAAGTAATATTTAGG - Intergenic
1150947299 17:69761866-69761888 TTTTGAAGGTAGGAATAGATTGG + Intergenic
1153073374 18:1132588-1132610 ATATGAAGGAAGAAATTTTTTGG - Intergenic
1153314665 18:3710236-3710258 ACCAAAAGGAAGGAATATTTAGG + Intronic
1153330817 18:3872150-3872172 TTTTAAATGTAGGAATATTTAGG - Intronic
1155968824 18:32061520-32061542 AACTGAAGGTAGGGAAAGTTGGG - Intronic
1157757609 18:50232461-50232483 ATCTGAAGGAATGTATTTTTAGG - Intronic
1157962795 18:52175623-52175645 ATGTGAAGGTGGGAATAGTTTGG - Intergenic
1159318528 18:66813571-66813593 AACTGAAGGTAGAAAGATGTTGG + Intergenic
1159426285 18:68291569-68291591 ATCTGCAGGAAGGAAAAATTTGG + Intergenic
1160539069 18:79610604-79610626 ATCTGAAGGGAGGCACATTCTGG - Intergenic
1164800805 19:31074788-31074810 ATCTGAAGACAGAAATATATAGG + Intergenic
1168453652 19:56486903-56486925 GTCTGAGGGTATGAATTTTTAGG + Intergenic
925048534 2:793140-793162 CTCTGAAGAAAAGAATATTTGGG + Intergenic
925924705 2:8661667-8661689 GTCTGAAGGTTGGAAGAGTTTGG - Intergenic
929814216 2:45218797-45218819 ATGTGGAGTCAGGAATATTTTGG + Intergenic
929957723 2:46471449-46471471 ATCTAAAGGTAGGCTGATTTAGG - Intronic
933581979 2:84137727-84137749 ATCTGAAGAAAGAAAAATTTTGG + Intergenic
934165742 2:89292766-89292788 GTCTGAAGGTTGGAGTATTAGGG + Intergenic
934201535 2:89889690-89889712 GTCTGAAGGTTGGAGTATTAGGG - Intergenic
936812682 2:116421094-116421116 ACATGAAGTTAGGAATATCTGGG + Intergenic
937084713 2:119163384-119163406 ATGAGAAGGTGGGGATATTTGGG + Intergenic
937474950 2:122207032-122207054 ATCTTGAGGTAGGAATCTCTGGG + Intergenic
937973473 2:127566991-127567013 TTCTGAAGGAAGGAAGCTTTGGG - Intronic
939037299 2:137148468-137148490 AGAAGAAGATAGGAATATTTGGG + Intronic
942397571 2:175567872-175567894 AACTGAAAGTAGGGACATTTTGG + Intergenic
944505969 2:200411210-200411232 ATCTGCATGTAAGAGTATTTAGG - Intronic
945307566 2:208273151-208273173 ATATGAAGGCAGGGATTTTTTGG - Intronic
945844046 2:214921920-214921942 ACCAGGAGGTAGGAATAATTGGG + Intergenic
946815772 2:223577210-223577232 ATCTGAAGCTGGGAAGAGTTGGG + Intergenic
946941580 2:224775072-224775094 ACCTGGATGTAGGCATATTTGGG + Exonic
947205724 2:227659362-227659384 AACTGCAGGTAATAATATTTTGG - Intergenic
947212109 2:227717928-227717950 TTCTGTAGGTAAGAATATCTCGG - Exonic
947392916 2:229657558-229657580 ATCTGGAGGTAGGTATCTTTAGG - Intronic
1168841442 20:912477-912499 AGCTGCAGGCAGGAATATTGAGG - Intronic
1170974264 20:21147662-21147684 CTCTGAAGGTAAGAAAATTGTGG - Intronic
1173437380 20:43045261-43045283 AACTGAAGGGAGGAATTTTAGGG - Intronic
1173477867 20:43374959-43374981 AGCAGAAGGTAGGAAAAATTAGG - Intergenic
1174825802 20:53767223-53767245 ATTTGAAGGTGGGGATCTTTGGG + Intergenic
1174832778 20:53828388-53828410 ATCCGATTGTAGGAAAATTTCGG + Intergenic
1175126583 20:56756806-56756828 CTCTGCAGTTAGAAATATTTTGG + Intergenic
1177031743 21:15988745-15988767 ATCAGAAAGAAGGAAAATTTGGG - Intergenic
1177182844 21:17761903-17761925 ATCTGAAGGTGGGGAACTTTGGG + Intergenic
1178576124 21:33793220-33793242 ATCTAAAGGTAGGAATTTTAGGG + Intronic
1178749802 21:35291121-35291143 ATCTGAAGGTTGGAAAACTTGGG + Intronic
1181817763 22:25451476-25451498 ACCTGTAGGAAGGAATAGTTAGG - Intergenic
949924054 3:9027082-9027104 ATCTGATGGTACTAATATTCTGG - Intronic
950990778 3:17435131-17435153 CTCAGAAGGTAGGAAGATGTGGG - Intronic
951428238 3:22574965-22574987 ATGTGAAGTTAGGAATATTTAGG + Intergenic
952150264 3:30581476-30581498 ATCTGAAGGGAGAAATTCTTAGG - Intergenic
953713288 3:45293474-45293496 ATCTGCAGGCAGGAAAATGTGGG + Intergenic
955821836 3:62904653-62904675 ATCTGAAGGTGGCAATATTTTGG + Intergenic
956180291 3:66511205-66511227 AACTGAAGGTAATAATAATTTGG + Intergenic
958095254 3:88935954-88935976 ATCTGAATCTAGGAATATGCAGG - Intergenic
959983091 3:112540050-112540072 ATCTGAAGTTGAGAATATCTAGG + Intronic
962760204 3:138505121-138505143 ATATGTAAGTAGGAAGATTTCGG + Intronic
963045277 3:141097691-141097713 ATCTGCAGGTAGCTATATTTGGG + Intronic
963333482 3:143943688-143943710 ATCAGAAGGGATGAACATTTTGG + Intergenic
964374021 3:156031826-156031848 ATCTTAATGTAGGAACATATGGG + Intergenic
965058844 3:163756310-163756332 ATCTGAGGGTAGATATTTTTGGG - Intergenic
965596101 3:170412966-170412988 AGCTGAAGGAAGGGAAATTTGGG + Intergenic
966067847 3:175837780-175837802 ATCAGAGGGTAGTAATATTTGGG + Intergenic
966887487 3:184384805-184384827 ATCTGAAGGTGGGGACATATAGG + Intronic
970811695 4:20101967-20101989 ATTTGAATGTAGGAATATGATGG + Intergenic
974568899 4:63617731-63617753 ATTTCAAGGCAGGTATATTTGGG + Intergenic
976404759 4:84650684-84650706 ATAGGAAGCTAGAAATATTTGGG + Exonic
976927807 4:90523064-90523086 ATCTTCAGGTAGGAATATATTGG + Intronic
977056242 4:92195381-92195403 ATGTGAATATATGAATATTTAGG - Intergenic
977661903 4:99598462-99598484 ATCTTAAGGCAGCAATAATTTGG + Intronic
978591474 4:110329120-110329142 TTCAGAAGGTAGGAAGATGTGGG + Intergenic
979280760 4:118865082-118865104 ATTTGAAGGTGGGAATTTGTGGG + Intronic
980516385 4:133867668-133867690 ATTTGAAGGCAGGATTCTTTAGG + Intergenic
981002993 4:139846139-139846161 ATCTGTAGGTAGGAAAATTAAGG - Intronic
981354781 4:143776185-143776207 ATGTGAAGATAAGAATATTTTGG - Intergenic
981357739 4:143810167-143810189 AACTGAAGGTTGGAGAATTTAGG - Intergenic
982613564 4:157610804-157610826 ATCTGAAGGCAGGAATTTTAGGG - Intergenic
984523656 4:180830382-180830404 ACCAGAAGATAGGAATATTAGGG + Intergenic
984647602 4:182236043-182236065 ATCTGAAGGAAGGATTGTTTGGG + Intronic
986048550 5:4064921-4064943 ATCTGAAGGTGTGATGATTTTGG + Intergenic
986382675 5:7202515-7202537 ATCTCCAGGTAGAAATATTAGGG + Intergenic
986580095 5:9256799-9256821 GTCTGAAGGTAGGAATTTCAAGG + Intronic
986585493 5:9312794-9312816 ATCTGGTGTAAGGAATATTTTGG - Intronic
987637199 5:20559070-20559092 ATCAGAAGGAAGAAATATTTGGG - Intronic
987719755 5:21618203-21618225 ATCAGTAGAAAGGAATATTTGGG - Intergenic
987784053 5:22476042-22476064 ACATGAAGGGAGGAATAATTTGG - Intronic
991188717 5:63842966-63842988 ATCTGAAGGTAGCTCTAATTAGG + Intergenic
992379343 5:76221598-76221620 ATTTGAAGGTAGGCATAGTTTGG + Intronic
992775872 5:80088595-80088617 ATCAGAAGGTAGGGAGAATTTGG + Intergenic
993331177 5:86602296-86602318 ATGAGAAGGTTGGAGTATTTGGG - Intergenic
993377197 5:87162337-87162359 ATCTTAAGATAGGAAAATTTGGG + Intergenic
993427147 5:87780779-87780801 ATCTGAGGATAGCACTATTTTGG + Intergenic
993529774 5:89009864-89009886 ATCTGAAGGCAGGAGTAGATTGG - Intergenic
994837300 5:104872143-104872165 ATCTGAAGGAAGGAGTGTCTTGG - Intergenic
994918617 5:106012327-106012349 AGAAGAAGGTAGGAAGATTTGGG - Intergenic
996519613 5:124412586-124412608 ATTAGAATGTAGGAATCTTTGGG + Intergenic
998759134 5:145412539-145412561 ATTAGAAGGTAGGAAGATGTGGG - Intergenic
998879896 5:146635141-146635163 ATTTGAAAGTAGAAATATTAAGG - Intronic
1000802754 5:165748992-165749014 ATCTCACGTTAGGAATAATTAGG + Intergenic
1001800143 5:174536076-174536098 ACCAGAAGGAAGGAATAATTAGG - Intergenic
1003649158 6:7942747-7942769 TGCTGAAGGTCAGAATATTTGGG - Intronic
1008364606 6:50662825-50662847 ATCTGATGCTCTGAATATTTTGG - Intergenic
1011948403 6:92935311-92935333 CTCAGAAGATAGGAATATCTGGG - Intergenic
1012619561 6:101324595-101324617 ATTTGAAGTTTTGAATATTTGGG + Intergenic
1013153900 6:107475002-107475024 AAGTGAAGGAATGAATATTTTGG - Intergenic
1013581395 6:111538298-111538320 AAGTGAAGGTAGCAATGTTTGGG + Intergenic
1013827204 6:114228570-114228592 ATTTGAAGGTAAGCAAATTTAGG - Exonic
1013963587 6:115929084-115929106 ATCTAAAGGGAGGATTATTACGG + Intergenic
1014103757 6:117540385-117540407 AGTTGAATGTAGGAATATTAAGG + Intronic
1014438266 6:121444687-121444709 ATCTAAAGGTAGGATTATTTAGG - Intronic
1016101694 6:140109677-140109699 ATATGAAAGAAGAAATATTTGGG - Intergenic
1016503137 6:144745331-144745353 ATATGAAGGTATGACTATTTGGG - Intronic
1016889360 6:148990510-148990532 ATCTGAACGTCTGAATATCTGGG - Intronic
1017859857 6:158385766-158385788 ATCTGATGGCAAGACTATTTTGG - Intronic
1018623992 6:165759584-165759606 ATGTGAAGAAAGGAATATTAAGG + Intronic
1021177209 7:17462869-17462891 ATCTGAGGGTTGTGATATTTAGG + Intergenic
1021286512 7:18787608-18787630 ATCTGAAGGTAGGAATATTTAGG + Intronic
1030588996 7:111456822-111456844 AACTGAAGGTTGGAGAATTTAGG + Intronic
1031037992 7:116808862-116808884 ATCTGAATATAATAATATTTGGG + Intergenic
1033022225 7:137737725-137737747 ATATGAAGATAGTAATATATGGG - Intronic
1033331532 7:140420855-140420877 ACCTGAAGGAAGGAATATTTTGG + Intronic
1033686198 7:143643427-143643449 ATTTGAAGGTATGAAAATTGAGG + Intronic
1033689540 7:143723888-143723910 ATTTGAAGGTATGAAAATTGAGG - Intronic
1033698415 7:143814194-143814216 ATTTGAAGGTATGAAAATTGAGG - Intergenic
1036008022 8:4689287-4689309 ATATGTAGGAAGGTATATTTGGG + Intronic
1036116263 8:5963528-5963550 AGCTTCAGGTAGGATTATTTGGG - Intergenic
1038523289 8:28251918-28251940 ATTTCAAGGTAGTAAGATTTAGG + Intergenic
1039280586 8:35979745-35979767 ATCAGAAGGTAGGAATCATTGGG - Intergenic
1039553975 8:38463790-38463812 ATCTGAAGGGATTAATGTTTTGG - Intronic
1040698139 8:50027421-50027443 ATCAGAATGTAAGGATATTTGGG + Intronic
1042287710 8:67132456-67132478 AGCTGAAGGAAGGAAATTTTAGG + Intronic
1044391687 8:91660053-91660075 CTCTGAAGTTAGGAATTCTTTGG + Intergenic
1045451504 8:102331407-102331429 ATCTAGAGCTAGGAATATTGAGG - Intronic
1045898681 8:107248163-107248185 AGCTGAAGGAAGGGACATTTGGG + Intergenic
1046422032 8:113999102-113999124 ATCTGGGGGAAAGAATATTTAGG + Intergenic
1046562468 8:115855319-115855341 ATCTTGAGGTAGGAGTATTTTGG - Intergenic
1046592676 8:116225008-116225030 TTCTGAAAGTAGAAATGTTTTGG - Intergenic
1047145764 8:122197552-122197574 CTTTGGAGCTAGGAATATTTGGG + Intergenic
1047602203 8:126437110-126437132 AAGTTAAGGTAGGAATAGTTTGG - Intergenic
1048696501 8:137034482-137034504 ATTTCAACATAGGAATATTTGGG - Intergenic
1050325497 9:4493181-4493203 ATCTGAAGGAACAAATATCTAGG - Intronic
1051761107 9:20465681-20465703 CTCTGAAGTTAGGACAATTTTGG - Intronic
1052223971 9:26061588-26061610 ATGTTCAGGTAGGAATATCTTGG - Intergenic
1053356978 9:37454512-37454534 ATCTGCAGGAACAAATATTTAGG + Intronic
1053633948 9:39975608-39975630 AGCTGCAGGGAGGGATATTTGGG - Intergenic
1053771797 9:41487896-41487918 AGCTGCAGGGAGGGATATTTGGG + Intergenic
1054209939 9:62275089-62275111 AGCTGCAGGGAGGGATATTTGGG + Intergenic
1054315054 9:63573865-63573887 AGCTGCAGGGAGGGATATTTGGG - Intergenic
1054761088 9:69004791-69004813 ATTTGAAGGAAGGAAAATTATGG + Intronic
1055359446 9:75473976-75473998 ATCATAAGGTAAGAATATTAGGG + Intergenic
1056938495 9:90936225-90936247 ATCTTATGGTAGGATGATTTAGG - Intergenic
1058088395 9:100776435-100776457 ATCCTAAGGTTGGTATATTTTGG + Intergenic
1058180072 9:101786874-101786896 ATCTCAAGGAAGGAATCTTCTGG - Intergenic
1188198921 X:27275847-27275869 ATGTGAAGGTAGTGATACTTCGG + Intergenic
1189756216 X:44274245-44274267 AGCTGAACATAGGACTATTTGGG - Intronic
1191944515 X:66517338-66517360 AGCTGAAGCTAGAAATGTTTTGG + Intergenic
1193371436 X:80702069-80702091 ATCTGTATGTAGGGATATCTAGG + Intronic
1193588080 X:83352188-83352210 ATCTGAATGCAAGCATATTTGGG + Intergenic
1197807426 X:130411159-130411181 AGCTGAATGTATTAATATTTAGG + Intronic
1198693228 X:139307109-139307131 AGATGGAGATAGGAATATTTGGG + Intergenic
1199993997 X:153007918-153007940 ATCAGAAGCTTGGAATGTTTAGG + Intergenic
1200834406 Y:7718776-7718798 ATCATAAGCTTGGAATATTTAGG - Intergenic