ID: 1021292128

View in Genome Browser
Species Human (GRCh38)
Location 7:18858867-18858889
Sequence CTGTGAGTTAGAAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021292128 Original CRISPR CTGTGAGTTAGAAGGGAAGT AGG (reversed) Intronic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
906568798 1:46818920-46818942 TTGTAGTTTAGAAGGGAAGTAGG + Exonic
907437579 1:54459296-54459318 ATGTGAGGTAGTAGGGAAGCAGG - Intergenic
907498085 1:54858415-54858437 TTGTGTGGTAGTAGGGAAGTGGG - Intronic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
909516819 1:76519126-76519148 CTGTGAGATACAAGGAAAGACGG - Intronic
910157660 1:84238092-84238114 CGGTGAGTGAGAAAGGAATTAGG - Exonic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
916337680 1:163691989-163692011 CTGTCATTTAGGAGGAAAGTGGG - Intergenic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
917667519 1:177239700-177239722 CTGTGAATGTGAAGGCAAGTGGG - Intronic
919088721 1:192952322-192952344 CTATGAGTTATGAGAGAAGTAGG - Intergenic
919724816 1:200874614-200874636 TTGTGAGTGAGAAGGGCAGGGGG - Intergenic
919726652 1:200888830-200888852 CTGGGAAGTGGAAGGGAAGTGGG - Intergenic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
923140111 1:231154575-231154597 TTGTGATTGAGAAGGGAAGATGG - Intergenic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924791954 1:247259484-247259506 CTTTGAGTCAAAAGAGAAGTTGG - Intergenic
1064452263 10:15453192-15453214 CTGTGATTTAGAAGAGACCTTGG + Intergenic
1065660203 10:27998638-27998660 CTGGGAGAGAGAAGGGAAGGGGG + Intronic
1067018640 10:42776088-42776110 CTGGGAGTTAGAAAGGACGAAGG - Intergenic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1070461186 10:76672043-76672065 CTGTCAAAGAGAAGGGAAGTTGG + Intergenic
1070694116 10:78549097-78549119 CTGAGAGGTAGAAGGGAAGAAGG + Intergenic
1073322939 10:102626584-102626606 CTGTGAATGGGAATGGAAGTTGG + Intronic
1074751097 10:116588073-116588095 CTGTGTGTTGTAATGGAAGTAGG - Intergenic
1076270059 10:129144567-129144589 ATGTGAGTTCAAAGGGAAGTAGG - Intergenic
1076622506 10:131801084-131801106 CTGTGAGCGAGTAGGGAAGCAGG + Intergenic
1077483198 11:2826238-2826260 CTGTGACTTGGAAGGAAAGAGGG + Intronic
1078654149 11:13222511-13222533 CTGTGAGTCAGAGGGGAGGTTGG - Intergenic
1078859228 11:15231991-15232013 CTGTGAGGTAGGAAGGAGGTTGG - Intronic
1080461925 11:32462249-32462271 AGGAGAGTTAGAAGGGGAGTGGG + Intergenic
1081489223 11:43554515-43554537 CTGGGAGATAGAAGAGAAGACGG - Intergenic
1081849755 11:46266846-46266868 ATGTGATTTGCAAGGGAAGTGGG - Intergenic
1083311958 11:61788331-61788353 CTGGGAGTTAACTGGGAAGTAGG - Exonic
1084325349 11:68396938-68396960 ATGTGAAGCAGAAGGGAAGTGGG - Intronic
1085316019 11:75545308-75545330 CTGTGAGTTAGAGTAGAATTTGG + Intergenic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1087418346 11:97887605-97887627 CTGGGAGTTAGAAGTTAGGTTGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089399305 11:118155273-118155295 CAGTGAGGTAGCAGGGAAGGTGG - Intergenic
1089706760 11:120283659-120283681 CTGAGAATGAGATGGGAAGTGGG - Intronic
1090022907 11:123143201-123143223 CTCTGTGTTAGAAGGGACATTGG + Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1091702801 12:2674821-2674843 CTGTTGGTTAGAAGGGAGGCAGG + Intronic
1091863350 12:3806636-3806658 CTGTGAACTAGAAAGGGAGTGGG + Intronic
1092212131 12:6653182-6653204 CTGAGGATTAGATGGGAAGTAGG + Intronic
1093922220 12:24871293-24871315 GTGTGAGGTAGCAGGGAACTGGG + Intronic
1094168193 12:27464160-27464182 CTCTGAGATAGAAGGGGAGTGGG + Intergenic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1095562197 12:43578822-43578844 CTGGGAGGAAGAAGAGAAGTTGG + Intergenic
1095737686 12:45575788-45575810 CTGGGAGTTGGAAGGGAAATAGG - Intergenic
1096289157 12:50326226-50326248 CTGTGAGGCAGATGGGAAATTGG + Intronic
1096741045 12:53694547-53694569 GTGTGAGTGGGAGGGGAAGTTGG + Intergenic
1099280134 12:80633419-80633441 CTGTAAATAATAAGGGAAGTAGG - Intronic
1100912643 12:99382966-99382988 GTGAAAGCTAGAAGGGAAGTGGG - Intronic
1101288017 12:103336522-103336544 TTGTGAGTTAGAAAGTAAGTTGG + Intronic
1101308915 12:103558347-103558369 CAGTGAGTTAAAACAGAAGTGGG - Intergenic
1102463607 12:113115230-113115252 CAGGGAGTTAGAACGGAAGAGGG + Exonic
1103705853 12:122871877-122871899 CAGTGAGTGAAAAGGGAACTAGG - Intronic
1104068752 12:125327189-125327211 CTGTGAGCTAGAAGGAGATTTGG - Intronic
1104243092 12:127010141-127010163 CTGAAAGAAAGAAGGGAAGTAGG - Intergenic
1104837970 12:131804159-131804181 CTGTGAGTGAGAAGGGGGCTAGG + Intergenic
1111276765 13:85958897-85958919 CTGTGAGTTAGAGTAGACGTAGG - Intergenic
1112925087 13:104663898-104663920 CTGAGAGTGAGAAAGGAAGCTGG - Intergenic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114850355 14:26376100-26376122 ATGAGAGTTAGTAGGGAAATGGG - Intergenic
1117357033 14:54934400-54934422 CTGGGAGTTAGGGGGAAAGTGGG - Intergenic
1118856821 14:69629515-69629537 CTCTGAGGTAGCAGGGAATTAGG - Intronic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120522582 14:85541809-85541831 CTGTGAGGTAGAAGGCATGGGGG - Intronic
1120934309 14:89878511-89878533 ATGTGATTTAGAAGGGCATTTGG - Intronic
1121301690 14:92876937-92876959 CTGTGTGCTAGAAGAGAATTAGG - Intergenic
1122945952 14:105009407-105009429 CTGTGACTTAGAAGTGTAGCCGG - Intronic
1123910878 15:24965644-24965666 TCGTGAGTTCGAAGGGAAATTGG + Intronic
1124552622 15:30695638-30695660 CTGGGAGATAGAACAGAAGTGGG - Intronic
1124678621 15:31710030-31710052 CTGGGAGATAGAACAGAAGTGGG + Intronic
1124907149 15:33880512-33880534 CTGTAAGTTAGGAGTAAAGTAGG + Intronic
1127775480 15:62261036-62261058 CTGTGAGGCAGATGGGAAATTGG + Intergenic
1129044823 15:72725441-72725463 ATGATAGTTACAAGGGAAGTGGG + Intronic
1129779435 15:78260395-78260417 CTCTGAATTGGAAGGGAAGCAGG - Intergenic
1129794201 15:78363614-78363636 CCTTGAGTTAGGAGGGAAGACGG + Intergenic
1129889183 15:79059496-79059518 CTCAGAGTGAGAAGGGAACTTGG + Intronic
1129993339 15:79983780-79983802 GTGTAGGTTAGAAGGCAAGTGGG - Intergenic
1131832247 15:96361333-96361355 ATGAGAGTTGGAAGGGAAGGGGG - Intergenic
1132071687 15:98783296-98783318 AGGAGAGATAGAAGGGAAGTAGG - Intronic
1132288221 15:100681295-100681317 GTCTGAGTTAGAAGAAAAGTGGG - Intergenic
1135177469 16:20243225-20243247 ATGTGTGTTAGAAGGGCAGTGGG + Intergenic
1136448346 16:30337634-30337656 ATTTGAGTTAGAAGAGAACTTGG - Intergenic
1138566247 16:57835082-57835104 CTGTGAGTAAGAACGGAGGCGGG + Intronic
1138587072 16:57977589-57977611 GTGTGTGTTGGAAGGGGAGTGGG + Intronic
1140685297 16:77427777-77427799 CTGTGAGTTGGCAGGGGAGGTGG + Intronic
1143002639 17:3804637-3804659 CTAAGAGTCAGAAGGCAAGTGGG - Intergenic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1145117781 17:20227607-20227629 CAGTGAGCTAGAAAGTAAGTGGG + Exonic
1146821544 17:35986766-35986788 CTGAGACTTGGAAGGGAAGTAGG + Intronic
1148462256 17:47845536-47845558 CTGGGAGCTATATGGGAAGTGGG - Exonic
1148541554 17:48484502-48484524 ATGTGAGTGAGAAGGGAGATGGG + Intergenic
1149363831 17:55920853-55920875 CTGTGAGGTATTGGGGAAGTAGG - Intergenic
1149753290 17:59166267-59166289 ATCTGAGTTTGAAGGGAAGGAGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1154343572 18:13524124-13524146 CTCTCAGTTACAAGGGAAGTCGG - Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155083316 18:22431523-22431545 CTGGGTTTTAGAAGGCAAGTAGG - Intergenic
1155581548 18:27313862-27313884 ATGTGGGTTGGAAGAGAAGTGGG + Intergenic
1155817601 18:30333595-30333617 CTGTGAGCTATAAGGGAGGCTGG + Intergenic
1157177838 18:45467457-45467479 CTGTGAGTTTCAAGGGGAGCTGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158869236 18:61668273-61668295 CTGGGAGGTAGAGGGGTAGTGGG + Intergenic
1159432754 18:68376730-68376752 GTGCAAGTTAAAAGGGAAGTAGG + Intergenic
1160709496 19:544535-544557 CAGTGAGGGAGAAGGGAGGTGGG + Intronic
1162856668 19:13473851-13473873 CTCAGAGTTAGAAGTGAAGGTGG - Intronic
1163496523 19:17649162-17649184 CTTTGAGTTAGAAGGGACCCTGG + Intronic
1163498848 19:17663484-17663506 CTGGGAGTTACATGGGAAGGTGG - Intronic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1164941267 19:32253546-32253568 CTGTAAGTTGGAAGGGAGGGAGG - Intergenic
1166315579 19:41987808-41987830 TTGTGAGTTAGATGGGAAAAAGG + Intronic
1168721664 19:58557951-58557973 CTGGGGGTTAGACGGGAACTTGG - Intronic
927032451 2:19136182-19136204 CTGTCAGTTATAAATGAAGTTGG - Intergenic
927145468 2:20162616-20162638 CTGTGGGTTAGAAGTGAGCTAGG + Intergenic
929249523 2:39737750-39737772 CTATGAGTTAAAAGACAAGTGGG + Intronic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929745462 2:44652943-44652965 ATGTGAATAAGAAGGGAAGCAGG - Intronic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
930835122 2:55784723-55784745 CTGTGAGGAAGACGGCAAGTTGG + Intergenic
931685384 2:64787860-64787882 CTCTCAGTTATAAGGGAAGCTGG - Intergenic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932236597 2:70125404-70125426 CTGCGGGGTAGAAGGGGAGTGGG - Intergenic
933247117 2:79987971-79987993 CTGTGTGGTTTAAGGGAAGTTGG + Intronic
936002529 2:108848275-108848297 ATGTGAAATAGAAGGGAATTAGG + Intronic
936701816 2:115019829-115019851 CTATGAGCTAGAAGGGACCTGGG + Intronic
936975753 2:118220442-118220464 GTGTGGGATAGAAGGGAATTTGG - Intergenic
938030162 2:127985622-127985644 CAGTGACATAGAAGGGGAGTAGG + Intronic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938395888 2:130947678-130947700 TTCTGTGTTAGAAGGGAATTGGG + Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939437034 2:142190759-142190781 CTGTTAGCTAGAAGGGAATATGG - Intergenic
941156587 2:161986567-161986589 ATGTGAATTAGAATGGAAATGGG + Intergenic
941253012 2:163190178-163190200 CTGAGTGCTAGAAGGGAAGAAGG + Intergenic
942328163 2:174793309-174793331 AGGTGACTTTGAAGGGAAGTAGG + Intergenic
942627214 2:177914510-177914532 CTGTGAGTTACAAAGGCAGATGG - Intronic
943026040 2:182629594-182629616 CTGTGTGTTAGAAAGATAGTAGG - Intergenic
944991466 2:205241901-205241923 ATGTGAGTTATAAAGGAAGTTGG + Intronic
947454793 2:230244389-230244411 CAGTGAGTCAGCAGGGATGTGGG - Intronic
947624823 2:231612908-231612930 CTGGGAGGGAGAAGGGAAGGGGG + Intergenic
948679737 2:239625747-239625769 CCATGGGTTAAAAGGGAAGTGGG - Intergenic
948918267 2:241049226-241049248 CCGAGAGTCAGAAGGGAAGTAGG - Intronic
1170287218 20:14723046-14723068 CTGAGAATTAAAAGAGAAGTGGG - Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1175778002 20:61665086-61665108 CCCTGAGTCAGAAGGGAGGTGGG + Intronic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1179067690 21:38041604-38041626 CAGTGAGTGAGAAGAAAAGTGGG - Intronic
1182341337 22:29623652-29623674 CAGTCAGGCAGAAGGGAAGTTGG + Intronic
1184898425 22:47426124-47426146 CTTTGAGGCAGAATGGAAGTGGG + Intergenic
1185184099 22:49382267-49382289 TCCTGAGTTAGGAGGGAAGTGGG + Intergenic
950785171 3:15428086-15428108 CTGTGAGGTAGAAGAATAGTAGG - Intronic
951509804 3:23487691-23487713 CTCTGAGTTACAAGGTAAGTGGG + Intronic
952412609 3:33063103-33063125 CTGTGCGTCAGAAGGTAAGTAGG + Intronic
954668631 3:52275420-52275442 CTGGTAGTTAGGAGGGAACTGGG - Intronic
954967279 3:54622953-54622975 CTGTGATTAAGAAGGGGAGGAGG + Intronic
955225311 3:57055607-57055629 GTGTGAGGTAGAAGTGAGGTAGG + Intronic
955433581 3:58874935-58874957 AAATGAGTCAGAAGGGAAGTTGG + Intronic
956043449 3:65170763-65170785 CTGGAAGTTGGAAGGGAATTTGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958124370 3:89336694-89336716 CTTTTAGTTGGAAGGGCAGTGGG - Intronic
963598441 3:147357096-147357118 CTTTTAGTTGGAAGGGATGTGGG - Intergenic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
968498875 4:934986-935008 CTGAAAGTGAGAGGGGAAGTAGG + Intronic
970246327 4:14067931-14067953 CTGGGAGGTAGAGGGGAAGGGGG + Intergenic
970961152 4:21872246-21872268 CTGTGAGAAAGAAGGTAGGTGGG - Intronic
975590449 4:75994516-75994538 CTCTGAGTGAGAAGGGAAGTTGG - Intergenic
975591192 4:76001675-76001697 CTGTGAGATGCAAGGTAAGTGGG + Exonic
975998180 4:80340523-80340545 TTGTGAGGTGCAAGGGAAGTGGG - Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
977982252 4:103337971-103337993 CTATGAGGTAGAAGGAAAGTAGG + Intergenic
978576337 4:110194089-110194111 CATTGAGTGAGAAGGGAAGCTGG - Intronic
979296159 4:119034677-119034699 CTCTGAGGGAGATGGGAAGTGGG + Intronic
980591316 4:134893042-134893064 CTGTGACTCAGAAGAGAAGCTGG - Intergenic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
983573355 4:169233973-169233995 CTGTGAATCAGAATGGCAGTTGG - Intronic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
986524368 5:8657189-8657211 CTGTAAGTTAGAAGGAAATCAGG + Intergenic
989217005 5:38915409-38915431 CTGAGAGTTGGAAGAAAAGTTGG + Intronic
990000678 5:50888130-50888152 ATGTGATTGAGCAGGGAAGTAGG - Intergenic
991154073 5:63409644-63409666 CACAGAGTTAGAAGGTAAGTGGG + Intergenic
992811271 5:80390947-80390969 ACGTGAGTCAGAAGGGAAGGTGG + Intergenic
993041729 5:82822314-82822336 CTGTGAGTTAGAAAGGGAAGAGG + Intergenic
993477970 5:88388507-88388529 CAATGAGAAAGAAGGGAAGTGGG + Intergenic
993983304 5:94568576-94568598 CTGTGAGTTTTAAGTGAAGTGGG - Intronic
996656878 5:125950418-125950440 ATGTGTGTTAGAAGGTGAGTTGG - Intergenic
997448740 5:133964409-133964431 GGGTGAGGTAGGAGGGAAGTGGG + Intronic
997570687 5:134924992-134925014 CTGTGAGTTTTAAGTAAAGTGGG + Intronic
997845968 5:137286314-137286336 CTATGAGTAAGAAGGGATGTAGG + Intronic
997964709 5:138347896-138347918 CTATGACTTAGAAGGGCAGAGGG - Exonic
998173749 5:139887512-139887534 CTGTGGGTTACAAGGCAGGTAGG + Intronic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
1001043382 5:168353099-168353121 CTGTGGGGTAGAAGGAACGTGGG - Intronic
1001423689 5:171608859-171608881 CTAAAAGTTATAAGGGAAGTGGG + Intergenic
1001707429 5:173751554-173751576 AGGTGATTTAGAAGGGAACTAGG - Intergenic
1002984111 6:2171370-2171392 CTGTGAGAAAGAAGAGAACTAGG - Intronic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1004501348 6:16212971-16212993 ACATGAATTAGAAGGGAAGTGGG + Intergenic
1004910785 6:20280721-20280743 CTGTGAGTGAGAAGGGTGGGAGG + Intergenic
1006090454 6:31625687-31625709 CTATGAGATAGAAGGGAGGGTGG + Intronic
1006145513 6:31956920-31956942 CTGTGAGTGACAGGGGAAATGGG - Exonic
1006318460 6:33304842-33304864 CTGGGAGTTAGAGGGGTAATGGG - Intronic
1006394735 6:33779948-33779970 ATGTGGGTTAGGATGGAAGTGGG - Intronic
1007544104 6:42678403-42678425 TTGTGAGTTAACAGGCAAGTGGG - Intronic
1009299574 6:61997751-61997773 CTGGGAGTTAGTAGGGAACAAGG - Intronic
1009662160 6:66628070-66628092 CAGTCCGTGAGAAGGGAAGTAGG - Intergenic
1009974891 6:70662039-70662061 GTGTGTGTGAGAAGTGAAGTAGG - Intergenic
1010165503 6:72910670-72910692 ATTTGAGTTAGAAGAGAAGGAGG - Intronic
1012635890 6:101541196-101541218 CAGTGAATTAGAAAGGAAGTTGG + Intronic
1013854758 6:114558920-114558942 CTGTGAGATAGAAGAAAAATGGG + Intergenic
1014831261 6:126105423-126105445 CTGGCAGTCAGAAGGGACGTGGG + Intergenic
1014992229 6:128094988-128095010 AGGTGAGTTTGAAGGGAAGGTGG + Intronic
1015139461 6:129913260-129913282 TTGTGAGTTGAAAGTGAAGTTGG + Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1019727143 7:2609288-2609310 CAGCGAGTTAACAGGGAAGTTGG + Intronic
1021014027 7:15509957-15509979 CTGTGAGTGAGAATGTAAATTGG + Intronic
1021292128 7:18858867-18858889 CTGTGAGTTAGAAGGGAAGTAGG - Intronic
1021907296 7:25347695-25347717 CTGTGAGGTAGGAGGGAATTGGG + Intergenic
1022545118 7:31180047-31180069 GTGTGAGTGAGAAGGAAAGCTGG + Intergenic
1024977327 7:55125949-55125971 CTGAGAGTGTGAGGGGAAGTGGG - Intronic
1026202476 7:68226254-68226276 CTGTGAGTTGGAAAGGATGAAGG - Intergenic
1026860063 7:73780447-73780469 GGTTGAGTTAGAAGGGAAGTAGG - Intergenic
1027336808 7:77159728-77159750 CTGTTAGTGGGAAGGTAAGTTGG - Intronic
1029294757 7:99531238-99531260 CTGTGAGTTTCAAGGCAAGCTGG + Exonic
1029778982 7:102711383-102711405 CTGTTAGTGGGAAGGTAAGTTGG + Intergenic
1030153158 7:106426341-106426363 CTTTGAGCTAGAAGGGAAGAGGG - Intergenic
1031706624 7:124988567-124988589 CTGTGCTTTAGAAGGGAACCAGG - Intergenic
1033291909 7:140092407-140092429 CTGTGACTTGCCAGGGAAGTGGG - Intronic
1034453473 7:151150643-151150665 CTGTGAGGGGGAAGGGAACTTGG - Intronic
1035383047 7:158452559-158452581 CTGTGAGTGGGAGGGGAAATCGG - Intronic
1035941176 8:3902865-3902887 CTGTTAGATGGAAGGAAAGTTGG - Intronic
1037268049 8:17089937-17089959 CTGTGATTCAGAAGGGAAAAGGG + Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1039471403 8:37815624-37815646 CTGTGAGTTGTTAGGGAAATGGG + Intronic
1041379186 8:57235060-57235082 CTGGGAGTCAGAAGGGTAGGAGG + Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1042884195 8:73530103-73530125 TAGTGAGTTGGAAGGGAACTGGG + Intronic
1043116594 8:76262213-76262235 TTGGGAGTAAGAAGGGAAATAGG - Intergenic
1044035328 8:87295729-87295751 CTGACATTTAGAAGGAAAGTTGG + Intronic
1044268641 8:90213319-90213341 ATATGTGTTAGAAGGGAAGATGG - Intergenic
1044965094 8:97566822-97566844 TTGTGAGTTAGACAGGAAGTGGG + Intergenic
1045743621 8:105390206-105390228 CTGTTAGTCAGAAGTGCAGTTGG - Intronic
1048117291 8:131538942-131538964 GTTTGAGATAGAAGTGAAGTTGG - Intergenic
1049192866 8:141298472-141298494 CTGTGAGCTAGCAGGGGACTGGG - Intronic
1049306067 8:141904978-141905000 CTGAGACATAGGAGGGAAGTGGG - Intergenic
1050405995 9:5309260-5309282 CAGAGAGTGAGAAGGGATGTGGG - Intergenic
1051465755 9:17375728-17375750 CTTAGAGTTAGAAGGAAATTTGG + Intronic
1052205973 9:25840799-25840821 TTGTGAGTTATAAGTGTAGTGGG - Intergenic
1052459932 9:28750076-28750098 CTGTGAGTAAAAAGAGAATTGGG - Intergenic
1052935138 9:34086814-34086836 CTGGGTGTAAGAAGGGAAATTGG - Exonic
1054830777 9:69622221-69622243 CTGTGAGTCATAGGGCAAGTGGG - Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057982936 9:99680565-99680587 CTTTGAGTGAGAAGGGAACTTGG + Intergenic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1059831167 9:118097626-118097648 CTGTGACTTCCAAGAGAAGTTGG + Intergenic
1061097906 9:128470643-128470665 CTTTGAGTTATAGGGGAAGAAGG - Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1189432455 X:40959643-40959665 CTGCGTGGTAGATGGGAAGTTGG + Intergenic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1191155040 X:57265346-57265368 CTGTGAGGTGCAACGGAAGTGGG - Intergenic
1191965271 X:66750915-66750937 ATGTGAGTTGTCAGGGAAGTGGG + Intergenic
1192657361 X:73004759-73004781 CGGTGTGTTAAAAGGGAAGGCGG - Exonic
1192664760 X:73078248-73078270 CGGTGTGTTAAAAGGGAAGGCGG + Exonic
1193274622 X:79570891-79570913 CTGTGAGGTAACATGGAAGTGGG + Intergenic
1194151114 X:90325961-90325983 CTGTGAGTCACAGTGGAAGTGGG - Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195345081 X:103941453-103941475 CTGTTAGTGAGAATGTAAGTTGG - Intronic
1195380958 X:104270410-104270432 CTGTGAGATAGAAAGGCAGATGG - Intergenic
1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG + Intergenic
1197679049 X:129362897-129362919 CTGTGACTTTTAAGGGCAGTAGG - Intergenic
1197683459 X:129411908-129411930 CAGTGAGTTAGAAGAGAGTTGGG - Intergenic
1198295520 X:135283060-135283082 CTGGGAGTTAGGGAGGAAGTAGG - Intronic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199001700 X:142646658-142646680 CTCATAGCTAGAAGGGAAGTTGG - Intergenic
1199612836 X:149632193-149632215 TTGGGAATTGGAAGGGAAGTTGG - Intergenic
1200305133 X:155017328-155017350 CTGTGAGTTAGAAGTCCAGGTGG - Intronic
1200497482 Y:3902715-3902737 CTGTGAGTCACAGTGGAAGTGGG - Intergenic