ID: 1021294055

View in Genome Browser
Species Human (GRCh38)
Location 7:18881888-18881910
Sequence ACCAGGTACCACTTCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021294048_1021294055 26 Left 1021294048 7:18881839-18881861 CCACAGCAAACATGTATGGAGAA 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021294055 Original CRISPR ACCAGGTACCACTTCATGAA GGG Intronic
900842923 1:5070226-5070248 AACTGGAATCACTTCATGAATGG - Intergenic
901578292 1:10218865-10218887 ACCAGTTACTACTTCTAGAAAGG + Intronic
906475017 1:46163721-46163743 ACCAGTTGCCACATCATCAATGG - Intronic
908643555 1:66251834-66251856 AGCAGGAACCTCATCATGAAGGG + Intronic
909835644 1:80250861-80250883 ACCATGTATCACTTGATGACAGG + Intergenic
911581817 1:99643110-99643132 AACAGGTCCCAATTCATGCAGGG - Intergenic
912037550 1:105338822-105338844 TCCATGTAACACTTCATAAATGG - Intergenic
912953904 1:114139420-114139442 ACCAGGAAAGACTTCATGAAAGG - Intronic
918527471 1:185480551-185480573 ACCAGTTTCCAGTTCAAGAAAGG - Intergenic
919733756 1:200931325-200931347 AGCAGGGACCAGATCATGAAGGG - Intergenic
924419994 1:243899008-243899030 ATTAGGTACCACTTTATAAAGGG - Intergenic
924766787 1:247040089-247040111 CCTAGGTACCACTGCAAGAATGG - Intronic
924831480 1:247600185-247600207 ACCAAGCACCACTGCATGAGAGG + Intergenic
1065598429 10:27341939-27341961 ACCATATTCCACTTCATGGAAGG - Intergenic
1067712478 10:48660682-48660704 ACCATGTACCACTTCACAAGAGG + Intergenic
1068249134 10:54413326-54413348 TCCAGGAACCACTTGATCAAAGG + Intronic
1068385669 10:56324094-56324116 ACCAGGTTGCGCTGCATGAATGG - Intergenic
1075016817 10:118915757-118915779 ACCAGGTGTCACTTCAGTAAAGG - Intergenic
1081607323 11:44535542-44535564 AGCAGGTACCATTTCATGGAAGG - Intergenic
1082716154 11:56616279-56616301 ACAAGGTACCTCTACATTAAGGG - Intergenic
1083684203 11:64366538-64366560 AGCAAGGACCACATCATGAAGGG - Intronic
1085358020 11:75857275-75857297 ACCAAGAACCAGATCATGAAAGG - Intronic
1085405603 11:76259992-76260014 AACAGGGACCAGTTCATGGAGGG + Intergenic
1086073887 11:82829495-82829517 ACCAGGGAAGACTTCATCAAGGG - Intronic
1087438080 11:98148131-98148153 ATCAGGAACCACTTAATGACAGG + Intergenic
1089701026 11:120243820-120243842 ACAAGGTGCCACTTCAGGATTGG - Intronic
1092849237 12:12611990-12612012 ACGAGGGACCAGTTCAGGAATGG - Exonic
1098653113 12:72999838-72999860 ACACTATACCACTTCATGAATGG + Intergenic
1101293830 12:103400363-103400385 AGAAGGCAACACTTCATGAAAGG - Intronic
1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG + Intergenic
1102772068 12:115486693-115486715 ACCAGGTACCACTTCATATCAGG + Intergenic
1110963750 13:81664826-81664848 AATAGATACCACTTCTTGAAGGG - Intergenic
1114283132 14:21213017-21213039 ATCAGGAAACACTTCACGAAGGG - Exonic
1115633736 14:35270589-35270611 AACAGGTACCATTACCTGAAAGG - Exonic
1115971798 14:38952944-38952966 ACCAGGGGCCAGTTCATGCATGG + Intergenic
1119010298 14:70978601-70978623 ACCAGGTTGCATTTCCTGAAGGG + Exonic
1119213924 14:72853838-72853860 ACAATGTACCACGTCAAGAAAGG + Intronic
1120399173 14:84006619-84006641 ATTAGGCACCACTTGATGAAGGG - Intergenic
1121941045 14:98071123-98071145 ACCAGGAACCACTTTTTAAAGGG - Intergenic
1125088334 15:35758823-35758845 ACCTTGTTCCACTTCATGAAGGG + Intergenic
1125769939 15:42158424-42158446 ACCAGGTGCTACTACATGATGGG + Intergenic
1129327518 15:74808992-74809014 ACCAGGTAACACGGTATGAATGG + Intergenic
1129912141 15:79236772-79236794 ATCAGGAAACACCTCATGAAGGG + Intergenic
1130014528 15:80176400-80176422 GACAGGAACCACCTCATGAAGGG - Intronic
1130381263 15:83374261-83374283 ACCAGGTAGGACTTTCTGAAGGG + Intergenic
1132039803 15:98515615-98515637 ACCAGATACCACATCATCGAAGG + Intergenic
1136504484 16:30694191-30694213 CCCATGTTCCACTTTATGAAGGG - Intergenic
1137916019 16:52431055-52431077 CCCTGATAGCACTTCATGAAGGG - Intergenic
1139679366 16:68549109-68549131 AGCAGGCACCACTTCCTGACTGG - Intronic
1140133447 16:72184141-72184163 ACCTGGGACCATTTCAGGAATGG - Intergenic
1141671010 16:85491691-85491713 ACCAGCTGCCCCTTCCTGAAAGG - Intergenic
1145120914 17:20258771-20258793 GTTAGGTACAACTTCATGAAAGG - Intronic
1147383160 17:40067466-40067488 ACTAAGTACCACTCCATGGAGGG - Intronic
1149019691 17:51948622-51948644 ACCAACTACCACTTCAGGGACGG - Intronic
1153267202 18:3283357-3283379 AGCAGGGACCACTTGCTGAAAGG + Intergenic
1153329021 18:3853638-3853660 ACCAGGCATCACTTAATGACGGG - Intronic
1154529186 18:15326690-15326712 ACCATATTCCACTTCATGGAAGG - Intergenic
1155018458 18:21871675-21871697 TGCAGGTACCACTTCATGCTAGG + Intergenic
1159165921 18:64699958-64699980 ACCAGCTACCTATTCTTGAAAGG - Intergenic
1159401494 18:67942331-67942353 ACCAGCTGCTAATTCATGAATGG - Intergenic
1160048456 18:75409043-75409065 ACAAGGACACACTTCATGAAGGG - Intronic
1165006167 19:32809180-32809202 ACCAGGTAACAGTTCAGGAGGGG - Intronic
925355271 2:3236589-3236611 GCCAGGTACCATTTCAGGACAGG + Intronic
926427697 2:12754393-12754415 CTCAGGTTCCACTTCAAGAAAGG - Intergenic
927175920 2:20407541-20407563 ACCAGGTCCTAGATCATGAATGG + Intergenic
929185745 2:39092111-39092133 GACAGGGACCACTTCATGTAGGG - Intronic
930025894 2:47028961-47028983 ACCAGGAAGCACTTCCTAAATGG - Intronic
932563853 2:72893627-72893649 ACCACCCACCACGTCATGAAAGG - Intergenic
937558493 2:123190449-123190471 ACCTGGTACCATTTGGTGAAGGG - Intergenic
938214544 2:129499896-129499918 TTCATGTACCATTTCATGAAGGG - Intergenic
938528288 2:132158104-132158126 ACCATATTCCACTTCATGGAAGG - Intronic
946625088 2:221603116-221603138 ACCAGATCCCAATTCATGATAGG + Intergenic
946787394 2:223262130-223262152 ACCAGGAACCACGTCCTGCAGGG + Intergenic
1171068033 20:22038237-22038259 ACCAATTACTACTTGATGAAGGG + Intergenic
1171789972 20:29514560-29514582 ACCAGTTACCAATAAATGAAAGG + Intergenic
1171857742 20:30362295-30362317 ACCAGCTACCAATAAATGAAAGG - Intergenic
1177459888 21:21396674-21396696 TCCAGGTGCCACTCCATGCAAGG + Intronic
1178010882 21:28285458-28285480 ACCAGGTAAAACGTGATGAATGG + Intergenic
1178631030 21:34261634-34261656 ACCAGGTACCACCTCTTCTAGGG + Intergenic
1179260854 21:39757175-39757197 ACCAGCTACCACTTCAAACAGGG - Intronic
1180390671 22:12279670-12279692 ACCAGTTACCAATAAATGAAAGG + Intergenic
1180409072 22:12585087-12585109 ACCAGTTACCAATAAATGAAAGG - Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
1181667506 22:24408318-24408340 AACAGTTACCACTCCATAAAGGG - Intronic
1181856895 22:25788282-25788304 GCCAGGTACAGCTTCATTAAGGG + Intronic
949844956 3:8360250-8360272 ACCAGGCACCACTGGATGAATGG - Intergenic
950702889 3:14762211-14762233 GCCTGGGATCACTTCATGAATGG - Intronic
958596910 3:96238455-96238477 TCCAGGTCCAACTTCAAGAAAGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
962417627 3:135197682-135197704 AGCAGAAAGCACTTCATGAAGGG + Intronic
965019328 3:163207236-163207258 ATCAGATCCCACTTTATGAAGGG - Intergenic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
966220582 3:177547367-177547389 AACATGTACCACTTCATCACAGG - Intergenic
966244024 3:177786025-177786047 TCCAGATACCACTTCCTGAGAGG + Intergenic
967119206 3:186367721-186367743 ACCTGGGACCACTTCGTGGAGGG - Intergenic
970015645 4:11509749-11509771 AGCAGGGGCCACTTCATGAAGGG + Intergenic
971253830 4:24995716-24995738 ACCAGGCTCCACCTCTTGAAGGG + Intergenic
974828456 4:67159641-67159663 ACCTAGTATCACTACATGAAAGG - Intergenic
977346511 4:95823235-95823257 ACAAGGCCACACTTCATGAAAGG - Intergenic
977493939 4:97750801-97750823 AGCAGGCAACACTTCATTAATGG + Intronic
982030383 4:151294676-151294698 ACCAGGTACCATTCCAGGCATGG + Intronic
983123584 4:163920163-163920185 ACCACTTACCATTTCATAAATGG - Intronic
983710547 4:170710319-170710341 AGCAGGTGTCACATCATGAAGGG - Intergenic
983817020 4:172143690-172143712 ACAAGATAAGACTTCATGAATGG - Intronic
984745619 4:183213230-183213252 ACCAGGTAGCACTTTAGGAATGG + Intronic
984820238 4:183875569-183875591 ACCAGCTACTGCTGCATGAAAGG - Intronic
985434785 4:189917745-189917767 ACCAGCTACCAATAAATGAAAGG - Intergenic
987294120 5:16535298-16535320 TCCAACTCCCACTTCATGAAGGG - Intronic
997176846 5:131787474-131787496 ACCAGCTACAACTTGATAAAAGG + Intronic
1003205253 6:4003551-4003573 TCCAGATCCCACTTCAAGAAAGG + Intergenic
1006027110 6:31154193-31154215 TCCAGGTACCAATTCATCAGGGG - Intronic
1008955500 6:57212125-57212147 GCCAGGTAGCAGCTCATGAAGGG - Intronic
1015546663 6:134368508-134368530 ACCAGGTTCCATTTGATGGAGGG + Intergenic
1018877623 6:167839074-167839096 AACAGGTAGCACTTCATGGTTGG - Intronic
1021256833 7:18402531-18402553 AACAGGGACCAGTTCATGGAGGG + Intronic
1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG + Intronic
1022245828 7:28558402-28558424 GTCAGGTAGCTCTTCATGAATGG - Intronic
1024779187 7:52826891-52826913 ACCATGTACCATTTAAAGAAGGG + Intergenic
1026232892 7:68500766-68500788 ACCAAGAGCTACTTCATGAATGG + Intergenic
1034389800 7:150776952-150776974 TCCAGGTATTACTGCATGAAGGG - Intergenic
1037173264 8:15918757-15918779 ACCAGGTACAAGTGCATGGAAGG + Intergenic
1037338721 8:17818082-17818104 ACCACTTTCCACTTGATGAATGG + Intergenic
1043705898 8:83350187-83350209 CACAGGTTCCACTTCATAAAAGG - Intergenic
1048598465 8:135892509-135892531 ACCAGGTAATACTTCTTGAGAGG + Intergenic
1050619884 9:7441373-7441395 AGCAGGTAGCACTTCCAGAATGG - Intergenic
1053706901 9:40764436-40764458 ACCATATGCCACTTCATGGAAGG - Intergenic
1053723840 9:40975805-40975827 ACCAGCTACCAATAAATGAAAGG - Intergenic
1054342120 9:63876194-63876216 ACCAGCTACCAATAAATGAAAGG + Intergenic
1054416815 9:64885202-64885224 ACCATATGCCACTTCATGGAAGG - Intergenic
1055558167 9:77496731-77496753 ACAATGTACCTCTTCAGGAAAGG + Intronic
1058216363 9:102238552-102238574 ACCAGCTGCCTCTTCATGGAAGG - Intergenic
1058682469 9:107452119-107452141 ACAGGGTCCCACATCATGAATGG + Intergenic
1061053065 9:128207408-128207430 ACCAGGCATCTGTTCATGAAAGG - Intronic
1061616974 9:131786783-131786805 TCCAGGCACCTGTTCATGAATGG - Intergenic
1192033107 X:67535951-67535973 ACCAGGGATCACTTGATGAGTGG + Intergenic
1192249041 X:69396096-69396118 CCCATGTACCACCTCATGAATGG + Intergenic
1196733622 X:118965314-118965336 AGCAGGTGCCAGATCATGAAAGG - Intergenic
1199306732 X:146275948-146275970 ACCAGGTACCATTATGTGAACGG + Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic