ID: 1021294587

View in Genome Browser
Species Human (GRCh38)
Location 7:18888848-18888870
Sequence GACAAAGTCGTTCCTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021294587_1021294588 11 Left 1021294587 7:18888848-18888870 CCTTTTTCAGGAACGACTTTGTC 0: 1
1: 0
2: 0
3: 15
4: 609
Right 1021294588 7:18888882-18888904 AACAATAGAGTCTATAGATAAGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021294587 Original CRISPR GACAAAGTCGTTCCTGAAAA AGG (reversed) Intronic
905351223 1:37347836-37347858 GTCAAAGTGGTGCCTGGAAAGGG - Intergenic
905782728 1:40726937-40726959 AAGAAAGTCGTTCCTTGAAATGG - Intronic
906269672 1:44466188-44466210 AACAAAGTGGTTTCTTAAAATGG - Intronic
908020106 1:59890319-59890341 GACAAAGACATTCCTGAGAATGG + Intergenic
910518272 1:88088213-88088235 GACAAAGTGCTTCGTTAAAATGG - Intergenic
910717194 1:90244990-90245012 GTCAAAATCTTTCCAGAAAAAGG - Intergenic
910792260 1:91063692-91063714 GACAAAGACATACCTGAAACTGG - Intergenic
911852155 1:102833707-102833729 GTCAAAGTGGTGCCTGAACAGGG + Intergenic
911901746 1:103514703-103514725 GACAAAGTTCTTGCTCAAAAAGG + Intergenic
913933246 1:125007391-125007413 CACAAAGTGGTTTCTGAGAATGG - Intergenic
917295633 1:173516161-173516183 GACAAAGTGGTTCGTTAAATGGG - Intronic
920913868 1:210242262-210242284 GAAAAAGTCCTTACGGAAAAAGG + Exonic
921728548 1:218551590-218551612 GACAGTTTCCTTCCTGAAAAGGG - Intergenic
924272122 1:242344825-242344847 GACAAAGACATACCTGAAACTGG + Intronic
924779323 1:247131923-247131945 GACAAAGTCTTTCATTAAACGGG + Intronic
924897677 1:248359843-248359865 GCTAAAGTCTTCCCTGAAAAAGG + Intergenic
1066712545 10:38251313-38251335 GACAAAGACATACCTGAAACTGG - Intergenic
1067537380 10:47123715-47123737 GACAAAATTGTTCATCAAAAGGG + Intergenic
1068173477 10:53425820-53425842 GATAAAGACGTACCTGAAACTGG + Intergenic
1068594196 10:58885038-58885060 GACACAGTTGATCCTCAAAATGG + Intergenic
1069221351 10:65888050-65888072 GAAAAACTTGTTCCTGAAGATGG + Intergenic
1073608083 10:104915600-104915622 GAAAAAGTAGGTCCTGAGAAAGG + Intronic
1076542404 10:131222676-131222698 GACATAGTCTTTCCTGAGTAGGG - Intronic
1079426120 11:20343319-20343341 GACAAAGTGCTTCATTAAAAGGG + Intergenic
1080500944 11:32870457-32870479 CCCAAACTCATTCCTGAAAAGGG + Intergenic
1080718941 11:34830603-34830625 GAGAATGTCTTTCCTGAAAGCGG - Intergenic
1082159627 11:48874774-48874796 GACAAAGAAGTTCCTGAGACTGG - Intergenic
1082516950 11:53909292-53909314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1083790020 11:64978549-64978571 GACAAAGACATACCTGAAACTGG + Intergenic
1084703652 11:70803465-70803487 GACAAAGTCCTGCCTGCAGAGGG + Intronic
1086359218 11:86039587-86039609 AACAAAGTTCTTCCTGAAGAAGG + Intronic
1086804190 11:91219359-91219381 GACACAGTCTTGCCTGAAGATGG - Intergenic
1087316951 11:96614615-96614637 GACAAAGTGTTTCATGAAATGGG - Intergenic
1088528503 11:110783155-110783177 GAAAAAGTTGCTCTTGAAAAGGG - Intergenic
1095016612 12:36987565-36987587 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1095031698 12:37293471-37293493 CACAAAGCAGTTCCTGAGAATGG - Intergenic
1095953549 12:47794495-47794517 GACAGACTCCTTCCTGGAAAAGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097924808 12:65115751-65115773 GGCAAAGTTGTCCATGAAAATGG + Intronic
1099407783 12:82284489-82284511 GATAAAGACGTTCCTGAAACAGG - Intronic
1103099329 12:118158940-118158962 GAAAAAGTTGTTCCTGACAGAGG - Intronic
1103429127 12:120866542-120866564 GGCAAAGTTTATCCTGAAAAAGG + Intronic
1104445508 12:128829830-128829852 GACAAAGTGGTACCAGAGAAGGG - Intergenic
1105436827 13:20386923-20386945 GATAAAGTCGTGCCTGAGACTGG - Intergenic
1106133140 13:26955614-26955636 CTCAAAGTCATTCCTGAAACAGG + Intergenic
1107304036 13:38999043-38999065 GATAACGTCGTAGCTGAAAAAGG + Intergenic
1111046040 13:82814032-82814054 GACAAAGACATACCTGAAACTGG - Intergenic
1114706029 14:24727154-24727176 GACAAAGTGCTTCCTTAAACAGG + Intergenic
1119162544 14:72465076-72465098 GAGAAAGACTTTCCTCAAAAAGG + Intronic
1126749384 15:51861128-51861150 GATAAAGTCGTCCTTGAAAAGGG + Intronic
1127234830 15:57037834-57037856 AATAAAGTCCTTCCTGAAAAAGG - Intronic
1129092872 15:73170019-73170041 TACAAAGTAGTTCCTGAAACTGG + Intronic
1131470877 15:92695770-92695792 GACAGCGTCAGTCCTGAAAAAGG - Intronic
1136712256 16:32248701-32248723 GAGGAAGTCCTGCCTGAAAAAGG + Intergenic
1136755659 16:32680703-32680725 GAGGAAGTCCTGCCTGAAAAAGG - Intergenic
1136812454 16:33189669-33189691 GAGGAAGTCCTGCCTGAAAAAGG + Intergenic
1136818930 16:33299749-33299771 GAGGAAGTCCTGCCTGAAAAAGG + Intronic
1136825493 16:33356282-33356304 GAGGAAGTCCTGCCTGAAAAAGG + Intergenic
1136830559 16:33455053-33455075 GAGGAAGTCCTGCCTGAAAAAGG + Intergenic
1136917822 16:34226467-34226489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1137029560 16:35508876-35508898 GAGGAAGTCTTGCCTGAAAAGGG + Intergenic
1137924438 16:52526582-52526604 GACAATGAAGTCCCTGAAAAGGG + Intronic
1141319487 16:82993996-82994018 GACATTTCCGTTCCTGAAAAGGG - Intronic
1141433909 16:83987130-83987152 AACAAAGTAGCTCCTGAATAAGG + Intronic
1202991031 16_KI270728v1_random:12639-12661 GAGGAAGTCCTGCCTGAAAAAGG + Intergenic
1203057801 16_KI270728v1_random:941059-941081 GAGGAAGTCCTGCCTGAAAAAGG - Intergenic
1145443983 17:23147161-23147183 CACAAAGTAGTTTCTGAGAAGGG - Intergenic
1145631199 17:25869091-25869113 CACAAAGTAGTTTCTGACAATGG - Intergenic
1145645083 17:26070217-26070239 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1145646502 17:26090914-26090936 CACAAAGTAGTTTCTGACAATGG - Intergenic
1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG + Intronic
1146327522 17:31899658-31899680 GATAAAGTCTTCCTTGAAAAGGG + Exonic
1146390087 17:32414003-32414025 GGCAGAATGGTTCCTGAAAAGGG - Intergenic
1146959577 17:36962262-36962284 GACAAAGTAGTAGCTCAAAAGGG - Intronic
1149513085 17:57258384-57258406 GCCCAGATCGTTCCTGAAAAGGG - Intronic
1151949080 17:77338950-77338972 GACAAAGTGGTTCCTGGAGATGG - Intronic
1159748812 18:72274062-72274084 GACAAAGACATACCTGAAACTGG - Intergenic
1164346393 19:27266169-27266191 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1168446304 19:56417882-56417904 GGGAAAGTCTTTCCTGACAAAGG - Intronic
927065014 2:19462583-19462605 GAGAACGTCATTCTTGAAAAGGG - Intergenic
927800724 2:26096494-26096516 AACAAAGTCAATCCAGAAAAAGG - Intronic
928139285 2:28714186-28714208 ATCAAAGTCGTTTATGAAAAAGG + Intergenic
931369255 2:61646966-61646988 GGCAAAGTGGTGCCTGAACAGGG - Intergenic
933462713 2:82609345-82609367 GATAAAGACATACCTGAAAATGG - Intergenic
937661942 2:124440329-124440351 AAAAAAGTCATTCTTGAAAAGGG - Intronic
937796885 2:126034062-126034084 AAGAAAGTCGTTTCTTAAAATGG + Intergenic
939855877 2:147357941-147357963 GGCAAAATAGTTCATGAAAAGGG + Intergenic
940691914 2:156928952-156928974 GACATAGTCATTCATGAAAACGG + Intergenic
942070076 2:172308360-172308382 GAAAGAGTCTTTCCTTAAAAGGG + Intergenic
942942245 2:181631921-181631943 GATAAATGCTTTCCTGAAAATGG - Intronic
947036730 2:225867085-225867107 GACAAAGTCAGTTCTGAATAGGG + Intergenic
1170525905 20:17237593-17237615 GACAAAGTCATTGTTGAAATAGG + Intronic
1171576942 20:26339098-26339120 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1171641163 20:27353959-27353981 CACAAAGTAGTTTCTGACAATGG - Intergenic
1172285402 20:33736943-33736965 GACAAAGTGTTTCCTCAAAATGG + Intronic
1176322155 21:5339704-5339726 GAAAAAGTCGTTTCTCAGAATGG - Intergenic
1177477804 21:21645844-21645866 GATAAAGACGTACCTGAAACTGG - Intergenic
1177714847 21:24826290-24826312 GAGAAATTCATTCCAGAAAATGG + Intergenic
1182156476 22:28078150-28078172 TACAAAGGAGTTTCTGAAAATGG - Intronic
1184268557 22:43364107-43364129 GACAAAGTCGGACCTGGAGATGG + Intergenic
953094673 3:39763472-39763494 GACAAATTAGCTCATGAAAATGG + Intergenic
958207968 3:90430085-90430107 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958208731 3:90439024-90439046 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958210674 3:90469831-90469853 GACAAAGATGTTTTTGAAAATGG + Intergenic
958272566 3:91522712-91522734 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958273371 3:91538599-91538621 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958403509 3:93721764-93721786 CACAAAGTTGTTTCTGAGAATGG + Intergenic
958404364 3:93733809-93733831 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958404603 3:93738410-93738432 CACAAAGTGGTTTCTGAGAATGG + Intergenic
958407433 3:93766794-93766816 CACAAAGTAGTTTCTGAGAATGG + Intergenic
960418914 3:117419424-117419446 GTCAAAGCAGTGCCTGAAAAAGG + Intergenic
960748643 3:120919748-120919770 TGCAAAGTCATTCCTAAAAAAGG - Intronic
962351197 3:134657057-134657079 GACAAAGACATACCTGAAACTGG + Intronic
963469169 3:145716641-145716663 GACATACTCTTTTCTGAAAATGG - Intergenic
966314494 3:178630551-178630573 TACAAATTCTTTCTTGAAAATGG + Intronic
966982446 3:185150941-185150963 CACAATGTCTTTCCTGAAATAGG - Intronic
967881557 3:194305434-194305456 GGCAAAGTCCTGCCTGAAATGGG + Intergenic
970082324 4:12301649-12301671 GACAAATTCTTTCCTGAAGAGGG - Intergenic
977679670 4:99785111-99785133 GAAAAAGTTGTTCTTGAACAGGG - Intergenic
979996363 4:127436365-127436387 GAGAATGTAGTTCCTGACAAAGG - Intergenic
981250241 4:142592725-142592747 TTCAAGGTCTTTCCTGAAAAAGG - Intronic
989859253 5:46345609-46345631 GACAAAGGAGTTTCTGAGAATGG + Intergenic
995017741 5:107330825-107330847 GTCAAAGTCATGCCTGAAGACGG + Intergenic
995594145 5:113730728-113730750 GACAAAGTAGTTCATTAAATGGG - Intergenic
996309526 5:122088797-122088819 GAAAAAGCAGTTCATGAAAAGGG - Intergenic
997139718 5:131365503-131365525 TAAAATGTGGTTCCTGAAAATGG - Intronic
999008815 5:148012005-148012027 AACATAGTGGTTCCTGATAAAGG + Intergenic
999040889 5:148410514-148410536 GACAAAGACGTACCTGAGACTGG - Intronic
999085167 5:148881809-148881831 CACAAAGTCCTTCTTGTAAATGG + Intergenic
999498239 5:152121294-152121316 GACAAGGTGGTTCCTTAAATGGG + Intergenic
1001460243 5:171905743-171905765 GACAAAGAGGTTACTGAATAAGG + Intronic
1001694828 5:173662153-173662175 GATAAAGACATACCTGAAAATGG + Intergenic
1002030055 5:176421434-176421456 GACAAAGACATTCCTGAGACTGG - Intergenic
1003208503 6:4037042-4037064 GAAAAAGTCGTCAATGAAAATGG + Intronic
1005020714 6:21415853-21415875 TACAAAGTCCTTCCTAAACATGG - Intergenic
1005120975 6:22389471-22389493 GACAAAGTGCTTCATTAAAATGG - Intergenic
1005483244 6:26274466-26274488 GACAAAGTCGTTCCAGGACACGG - Intergenic
1007787327 6:44288306-44288328 GAAAAAGCCTTTTCTGAAAAAGG - Intronic
1008741623 6:54615413-54615435 GACAAAGTGGTTCGTTAAATGGG + Intergenic
1009065232 6:58452529-58452551 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065513 6:58556440-58556462 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065727 6:58559497-58559519 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009065947 6:58562554-58562576 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009066165 6:58565613-58565635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009066385 6:58568673-58568695 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009066602 6:58571730-58571752 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009066822 6:58574792-58574814 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067041 6:58577846-58577868 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067260 6:58580906-58580928 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067480 6:58583964-58583986 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009067702 6:58587022-58587044 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009067922 6:58590081-58590103 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009068144 6:58593137-58593159 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009068370 6:58596195-58596217 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009068589 6:58599252-58599274 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009068806 6:58602290-58602312 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009069027 6:58605347-58605369 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009069245 6:58608404-58608426 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009069462 6:58611461-58611483 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009069683 6:58614519-58614541 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009069902 6:58617576-58617598 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070120 6:58620632-58620654 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070338 6:58623682-58623704 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009070551 6:58626740-58626762 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009070766 6:58629779-58629801 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009070985 6:58632836-58632858 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009071207 6:58635893-58635915 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009071423 6:58638951-58638973 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009071643 6:58642008-58642030 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009071862 6:58645065-58645087 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072079 6:58648123-58648145 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072295 6:58651180-58651202 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009072514 6:58654237-58654259 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072732 6:58657294-58657316 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009072953 6:58660351-58660373 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009073170 6:58663409-58663431 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009073390 6:58666466-58666488 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009073612 6:58669526-58669548 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009073830 6:58672577-58672599 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074052 6:58675635-58675657 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009074273 6:58678692-58678714 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074494 6:58681749-58681771 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009074714 6:58684806-58684828 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009074931 6:58687863-58687885 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075149 6:58690920-58690942 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009075372 6:58693976-58693998 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075586 6:58697033-58697055 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009075802 6:58700090-58700112 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009076023 6:58703147-58703169 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076239 6:58706204-58706226 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076455 6:58709262-58709284 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009076674 6:58712319-58712341 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009076898 6:58715377-58715399 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009077119 6:58718436-58718458 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009077340 6:58721493-58721515 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009077555 6:58724549-58724571 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009077775 6:58727606-58727628 GACAAAGTCGTTTCTGAGATTGG - Intergenic
1009077995 6:58730663-58730685 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009078211 6:58733720-58733742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009078437 6:58736779-58736801 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009078654 6:58739817-58739839 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009078875 6:58742874-58742896 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009079097 6:58745933-58745955 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079317 6:58748990-58749012 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009079539 6:58752048-58752070 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079756 6:58755106-58755128 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009079938 6:58757657-58757679 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080154 6:58760714-58760736 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080378 6:58763773-58763795 CACAAAGTCGTTTCTGAGAATGG - Intergenic
1009080599 6:58766830-58766852 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009080815 6:58769867-58769889 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009081035 6:58772924-58772946 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081256 6:58775982-58776004 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009081474 6:58779038-58779060 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081692 6:58782095-58782117 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009081909 6:58785153-58785175 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009082127 6:58788212-58788234 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082346 6:58791270-58791292 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082567 6:58794327-58794349 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009082782 6:58797384-58797406 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009083007 6:58800444-58800466 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083226 6:58803502-58803524 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083438 6:58806539-58806561 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009083661 6:58809596-58809618 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009083884 6:58812653-58812675 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084104 6:58815709-58815731 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009084325 6:58818767-58818789 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084544 6:58821825-58821847 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084766 6:58824882-58824904 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009084989 6:58827942-58827964 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085210 6:58830998-58831020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085429 6:58834055-58834077 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085643 6:58837093-58837115 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009085862 6:58840151-58840173 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086078 6:58843208-58843230 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086301 6:58846265-58846287 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009086520 6:58849323-58849345 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009086738 6:58852381-58852403 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009086958 6:58855438-58855460 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087174 6:58858475-58858497 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087397 6:58861534-58861556 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087614 6:58864591-58864613 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009087833 6:58867648-58867670 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088052 6:58870706-58870728 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088274 6:58873765-58873787 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009088494 6:58876822-58876844 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009088710 6:58879879-58879901 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009088928 6:58882918-58882940 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089146 6:58885955-58885977 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089366 6:58889012-58889034 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009089585 6:58892070-58892092 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009089803 6:58895127-58895149 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009090024 6:58898185-58898207 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090246 6:58901244-58901266 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090465 6:58904302-58904324 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090687 6:58907359-58907381 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009090906 6:58910417-58910439 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091124 6:58913473-58913495 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091341 6:58916530-58916552 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091558 6:58919587-58919609 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009091777 6:58922643-58922665 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009091993 6:58925680-58925702 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092213 6:58928738-58928760 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092433 6:58931795-58931817 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092654 6:58934853-58934875 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009092877 6:58937910-58937932 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093097 6:58940968-58940990 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009093314 6:58944025-58944047 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093532 6:58947082-58947104 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009093748 6:58950141-58950163 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009093965 6:58953197-58953219 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094184 6:58956254-58956276 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094401 6:58959311-58959333 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094619 6:58962369-58962391 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009094840 6:58965426-58965448 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095062 6:58968484-58968506 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009095279 6:58971542-58971564 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009095496 6:58974597-58974619 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095716 6:58977654-58977676 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009095935 6:58980713-58980735 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009096153 6:58983771-58983793 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009096373 6:58986829-58986851 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009096593 6:58989886-58989908 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009096817 6:58992943-58992965 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097039 6:58996001-58996023 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097260 6:58999056-58999078 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097480 6:59002111-59002133 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097703 6:59005169-59005191 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009097924 6:59008225-59008247 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009098143 6:59011282-59011304 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009098364 6:59014338-59014360 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009098578 6:59017375-59017397 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009098796 6:59020432-59020454 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099018 6:59023486-59023508 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009099239 6:59026543-59026565 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099463 6:59029597-59029619 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009099683 6:59032654-59032676 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009099902 6:59035709-59035731 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100121 6:59038766-59038788 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100342 6:59041824-59041846 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009100560 6:59044883-59044905 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009100784 6:59047940-59047962 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101005 6:59050998-59051020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101223 6:59054055-59054077 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009101442 6:59057112-59057134 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009101661 6:59060170-59060192 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009101882 6:59063229-59063251 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102103 6:59066286-59066308 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009102321 6:59069344-59069366 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102536 6:59072401-59072423 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102759 6:59075458-59075480 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009102975 6:59078495-59078517 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009103192 6:59081550-59081572 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009103420 6:59084607-59084629 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009103642 6:59087665-59087687 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009103863 6:59090723-59090745 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104085 6:59093781-59093803 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009104306 6:59096838-59096860 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009104527 6:59099895-59099917 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104750 6:59102952-59102974 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009104970 6:59106009-59106031 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105190 6:59109065-59109087 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105367 6:59111613-59111635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009105584 6:59114670-59114692 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009105803 6:59117727-59117749 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009106021 6:59120786-59120808 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009106237 6:59123841-59123863 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106457 6:59126900-59126922 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106680 6:59129950-59129972 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009106898 6:59133007-59133029 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009107338 6:59139123-59139145 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009107556 6:59142162-59142184 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108004 6:59148276-59148298 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009108222 6:59151335-59151357 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108443 6:59154394-59154416 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009108660 6:59157452-59157474 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009108880 6:59160509-59160531 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109099 6:59163566-59163588 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109318 6:59166624-59166646 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009109539 6:59169681-59169703 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009109753 6:59172736-59172758 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009109971 6:59175794-59175816 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009110191 6:59178850-59178872 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009110411 6:59181907-59181929 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009110630 6:59184961-59184983 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009110848 6:59187998-59188020 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111067 6:59191055-59191077 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009111284 6:59194114-59194136 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111502 6:59197173-59197195 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009111722 6:59200230-59200252 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009111939 6:59203287-59203309 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112160 6:59206344-59206366 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112382 6:59209402-59209424 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112597 6:59212439-59212461 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009112817 6:59215496-59215518 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113040 6:59218551-59218573 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009113258 6:59221608-59221630 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113477 6:59224667-59224689 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113694 6:59227719-59227741 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009113913 6:59230778-59230800 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009114133 6:59233836-59233858 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009114349 6:59236896-59236918 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009114570 6:59239953-59239975 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009114793 6:59243009-59243031 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009115011 6:59246066-59246088 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115227 6:59249125-59249147 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115445 6:59252183-59252205 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009115666 6:59255242-59255264 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009115887 6:59258300-59258322 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009116556 6:59267473-59267495 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009116721 6:59269682-59269704 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009116942 6:59272740-59272762 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009117162 6:59275797-59275819 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009117384 6:59278854-59278876 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009117602 6:59281912-59281934 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009117817 6:59284969-59284991 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118037 6:59288027-59288049 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118254 6:59291083-59291105 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118521 6:59294777-59294799 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118742 6:59297828-59297850 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009118960 6:59300884-59300906 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009119179 6:59303921-59303943 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009119403 6:59306978-59307000 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009119838 6:59313094-59313116 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120014 6:59315642-59315664 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120235 6:59318697-59318719 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120456 6:59321754-59321776 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009120672 6:59324812-59324834 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009120894 6:59327869-59327891 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121111 6:59330928-59330950 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009121316 6:59333814-59333836 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121535 6:59336870-59336892 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009121763 6:59339928-59339950 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009121984 6:59342986-59343008 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009122211 6:59346044-59346066 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009122427 6:59349102-59349124 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009122643 6:59352159-59352181 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009122865 6:59355196-59355218 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009123092 6:59358259-59358281 CACAAAGTCGTTTCTGAGAATGG - Intergenic
1009123304 6:59361297-59361319 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009123524 6:59364355-59364377 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009123748 6:59367414-59367436 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009123968 6:59370471-59370493 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009124190 6:59373528-59373550 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009124412 6:59376585-59376607 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009124628 6:59379641-59379663 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009124846 6:59382699-59382721 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125067 6:59385756-59385778 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009125286 6:59388816-59388838 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125502 6:59391873-59391895 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009125722 6:59394911-59394933 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009125944 6:59397969-59397991 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009126165 6:59401026-59401048 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009126381 6:59404085-59404107 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009126597 6:59407143-59407165 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009126819 6:59410203-59410225 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127040 6:59413260-59413282 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127260 6:59416317-59416339 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009127482 6:59419376-59419398 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009127708 6:59422435-59422457 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009127919 6:59425493-59425515 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128139 6:59428552-59428574 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128361 6:59431611-59431633 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009128581 6:59434663-59434685 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009128801 6:59437720-59437742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009129034 6:59440971-59440993 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129253 6:59444028-59444050 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129471 6:59447084-59447106 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009129692 6:59450143-59450165 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009129914 6:59453200-59453222 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009130355 6:59459314-59459336 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009130578 6:59462372-59462394 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131016 6:59468489-59468511 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131234 6:59471546-59471568 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009131451 6:59474603-59474625 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009131671 6:59477661-59477683 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009131894 6:59480720-59480742 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132114 6:59483779-59483801 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132332 6:59486836-59486858 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132548 6:59489893-59489915 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009132784 6:59493121-59493143 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009132998 6:59496179-59496201 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009133216 6:59499237-59499259 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133435 6:59502293-59502315 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133655 6:59505350-59505372 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009133873 6:59508408-59508430 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134097 6:59511465-59511487 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134320 6:59514524-59514546 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009134540 6:59517582-59517604 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009134762 6:59520640-59520662 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135033 6:59524389-59524411 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009135253 6:59527448-59527470 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135471 6:59530508-59530530 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135502 6:59530845-59530867 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009135691 6:59533566-59533588 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009135908 6:59536623-59536645 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009136131 6:59539680-59539702 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009136349 6:59542742-59542764 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009136567 6:59545800-59545822 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009136783 6:59548857-59548879 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137003 6:59551912-59551934 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137222 6:59554970-59554992 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137441 6:59558027-59558049 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137657 6:59561084-59561106 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009137885 6:59564142-59564164 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138107 6:59567200-59567222 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138328 6:59570241-59570263 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009138545 6:59573299-59573321 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009138917 6:59578569-59578591 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009139143 6:59581626-59581648 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009139367 6:59584684-59584706 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009139588 6:59587742-59587764 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009139809 6:59590801-59590823 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009140030 6:59593861-59593883 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140251 6:59596918-59596940 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009140466 6:59599976-59599998 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140689 6:59603035-59603057 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009140906 6:59606093-59606115 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009141130 6:59609149-59609171 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009141348 6:59612207-59612229 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009141789 6:59618318-59618340 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142007 6:59621355-59621377 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009142226 6:59624412-59624434 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142442 6:59627450-59627472 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009142668 6:59630509-59630531 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009142890 6:59633567-59633589 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009143106 6:59636604-59636626 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009143331 6:59639661-59639683 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009143558 6:59642719-59642741 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009143777 6:59645775-59645797 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144000 6:59648834-59648856 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144219 6:59651891-59651913 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009144442 6:59654947-59654969 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009144662 6:59658007-59658029 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009144878 6:59661044-59661066 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145099 6:59664101-59664123 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009145321 6:59667158-59667180 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145538 6:59670215-59670237 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009145755 6:59673272-59673294 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009145977 6:59676325-59676347 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146197 6:59679383-59679405 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146421 6:59682442-59682464 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146640 6:59685499-59685521 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009146859 6:59688556-59688578 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147075 6:59691613-59691635 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147292 6:59694670-59694692 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147514 6:59697728-59697750 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009147738 6:59700785-59700807 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009147959 6:59703842-59703864 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009148181 6:59706898-59706920 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009148400 6:59709954-59709976 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009148621 6:59713011-59713033 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009148840 6:59716069-59716091 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149055 6:59719119-59719141 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149273 6:59722176-59722198 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009149491 6:59725239-59725261 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149707 6:59728296-59728318 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009149925 6:59731353-59731375 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009150145 6:59734405-59734427 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009150364 6:59737461-59737483 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009150581 6:59740519-59740541 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009150802 6:59743577-59743599 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151017 6:59746636-59746658 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151240 6:59749695-59749717 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151461 6:59752752-59752774 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009151684 6:59755810-59755832 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009151903 6:59758868-59758890 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152123 6:59761925-59761947 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009152341 6:59764981-59765003 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009152561 6:59768037-59768059 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152779 6:59771094-59771116 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009152997 6:59774151-59774173 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153219 6:59777208-59777230 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153436 6:59780266-59780288 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009153663 6:59783324-59783346 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009153883 6:59786382-59786404 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154111 6:59789440-59789462 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154337 6:59792499-59792521 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009154560 6:59795556-59795578 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154779 6:59798613-59798635 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009154996 6:59801653-59801675 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155217 6:59804712-59804734 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155436 6:59807770-59807792 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009155465 6:59808107-59808129 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009155654 6:59810827-59810849 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009155873 6:59813884-59813906 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156091 6:59816941-59816963 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156325 6:59820259-59820281 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009156541 6:59823316-59823338 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1009156755 6:59826372-59826394 CACAAAGTCGTTTCTGAGATGGG - Intergenic
1009156980 6:59829430-59829452 CACAAAGTCGTTTCTGAGATTGG - Intergenic
1010549406 6:77202220-77202242 GATAAAGTCGTACCTGAGACTGG - Intergenic
1011183764 6:84651477-84651499 GAGAAAGAAGTTCATGAAAATGG - Intergenic
1011521771 6:88215029-88215051 TACAAAATGGTGCCTGAAAAGGG + Intergenic
1016101681 6:140109436-140109458 GACAAAGTCACTCAAGAAAATGG - Intergenic
1016134708 6:140525253-140525275 GACAAAGACATACCTGAGAATGG - Intergenic
1021116422 7:16750655-16750677 GATAAAGACGTACCTGAAACTGG - Intergenic
1021294587 7:18888848-18888870 GACAAAGTCGTTCCTGAAAAAGG - Intronic
1022962136 7:35437599-35437621 GACAGAGTCCTTCCTGATATGGG - Intergenic
1024164218 7:46714163-46714185 GACAAAGTCAATCCTGCAACTGG + Intronic
1025323352 7:58174250-58174272 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025331936 7:58326590-58326612 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025336719 7:58410978-58411000 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342532 7:58514200-58514222 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342591 7:58515222-58515244 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025343226 7:58526467-58526489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025348194 7:58614353-58614375 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025349131 7:58631044-58631066 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025351003 7:58664431-58664453 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025360520 7:58832834-58832856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025363103 7:58878492-58878514 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025380951 7:59194981-59195003 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384302 7:59254592-59254614 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384361 7:59255614-59255636 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025387967 7:59319649-59319671 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025388370 7:59326803-59326825 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025395628 7:59455906-59455928 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025403121 7:59588274-59588296 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025411029 7:59728289-59728311 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025427337 7:60018234-60018256 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025428938 7:60046834-60046856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025429905 7:60063868-60063890 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025433593 7:60129615-60129637 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025436351 7:60178671-60178693 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025436625 7:60183442-60183464 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025443920 7:60312917-60312939 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025444904 7:60330292-60330314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025468864 7:60757202-60757224 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025472074 7:60814440-60814462 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025537110 7:61962708-61962730 CACAGAGTAGTTCCTGAGAATGG - Intergenic
1025568328 7:62519175-62519197 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1026590801 7:71693984-71694006 GATAAAGTCGTACCTGAGACTGG + Intronic
1027364675 7:77445357-77445379 GGAAAAGACGTTCCTGACAAAGG + Intergenic
1028596602 7:92552574-92552596 TTCAAAGTCTTTCATGAAAATGG + Intergenic
1028749180 7:94363119-94363141 GAAAAAGTCTTTTCAGAAAATGG + Intergenic
1031141306 7:117946520-117946542 GCCAAAGCAATTCCTGAAAAGGG - Intergenic
1033488299 7:141813727-141813749 TTCAAAGTCTTTCCTTAAAATGG + Intergenic
1034875418 7:154720739-154720761 GGCAAAGGCCATCCTGAAAAAGG + Intronic
1035472048 7:159116593-159116615 GACTAAGTCGTTCAGAAAAACGG + Intronic
1037449766 8:19004989-19005011 GATAAAGACGTTCCTGAGACTGG - Intronic
1039934874 8:42033546-42033568 AAGAGAGTAGTTCCTGAAAAGGG - Intronic
1040143069 8:43949478-43949500 CACAAAGTAGTTTCTGAATATGG - Intergenic
1040143286 8:43954235-43954257 CACAAAGTTGTTTCTGAGAATGG - Intergenic
1040271728 8:45955681-45955703 CACAAAGTAGTTTCTGAATATGG - Intergenic
1040271991 8:45961463-45961485 CACAAAGTTGTTTCTGAGAATGG - Intergenic
1041693080 8:60708692-60708714 GACAAAATCGTACTTGAAATAGG - Intronic
1044277160 8:90315071-90315093 GACAAAGAAGATCCTGAGAAAGG + Intergenic
1050798862 9:9583461-9583483 GACAATGTCATTCATGAAAAAGG - Intronic
1052351598 9:27464663-27464685 GATAAAGACATACCTGAAAATGG + Intronic
1053711744 9:40818652-40818674 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1053991303 9:44082941-44082963 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054032058 9:44788341-44788363 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054422209 9:64950530-64950552 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1059466163 9:114470173-114470195 GACAAAGATTTGCCTGAAAAAGG - Intronic
1060909406 9:127337380-127337402 GGCACATTTGTTCCTGAAAAGGG + Intronic
1061356607 9:130110304-130110326 GACAAAAGCGTTCCTGTTAAAGG - Intronic
1062060699 9:134493816-134493838 GACAAGGGCGGTCCTGACAAGGG - Intergenic
1203786009 EBV:127970-127992 CACCAAGTCCATCCTGAAAAAGG + Intergenic
1186447434 X:9643512-9643534 GACAAAGACGTTTTTAAAAAAGG - Intronic
1187038907 X:15572274-15572296 GACAAAGTGCTTCTTGAAACTGG + Exonic
1189455854 X:41188988-41189010 GCCACAGTGGTTCCTGAGAAAGG + Intronic
1191275103 X:58535942-58535964 CACAAAGTAGTTTCTGACAATGG + Intergenic
1192859399 X:75050013-75050035 GACAAAGTAGTTTGTGAAGATGG - Intergenic
1195561074 X:106284563-106284585 GACAAAATGGTTCCTGAGAAGGG + Intergenic
1196110875 X:111945891-111945913 GAGAAAGGCCTCCCTGAAAATGG + Intronic