ID: 1021296245

View in Genome Browser
Species Human (GRCh38)
Location 7:18910026-18910048
Sequence TGTCCAATGCTGAGAGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021296245 Original CRISPR TGTCCAATGCTGAGAGAGTG GGG Intronic
901850489 1:12011875-12011897 TGTGCAATGCTGAGATCCTGAGG - Exonic
902863280 1:19260896-19260918 TGTCTAAAGCTGAGACAGCGTGG - Intergenic
902971731 1:20058202-20058224 TGTTCATTACTGAGAGAGGGTGG + Intronic
903232870 1:21932395-21932417 TGTCCTCTGCTTAGAGAATGGGG + Intronic
905498832 1:38419648-38419670 TGCACAATGCTGATAGACTGAGG - Intergenic
906141836 1:43538414-43538436 TGTGCACTGGTGAGAGATTGTGG + Intronic
907149427 1:52269418-52269440 TATCCAATCCTGATAGGGTGTGG - Intronic
907702954 1:56807018-56807040 GTTGCAATGCTGAGTGAGTGTGG - Intronic
908017305 1:59856857-59856879 TATCCAGTGCTGAGACAATGCGG + Intronic
913227539 1:116713355-116713377 TGTCCAGGCCTGAGGGAGTGGGG - Intergenic
913674096 1:121125239-121125261 TGTCCATTGCTGGGAAAGTGGGG - Intergenic
914025880 1:143912559-143912581 TGTCCATTGCTGGGAAAGTGGGG - Intergenic
914664316 1:149820280-149820302 TGTCCATTGCTGGGAAAGTGGGG - Intergenic
914671447 1:149873555-149873577 TGTCCATTGCTGGGAAAGTGGGG + Intronic
917976397 1:180242124-180242146 TGTCCAATCCTGAAGCAGTGGGG - Intronic
918672529 1:187237437-187237459 CATCCAATGCTGAGAGAATAAGG + Intergenic
919853995 1:201693446-201693468 TGCCCAGTGCTGCGAGGGTGTGG + Intronic
922564357 1:226591838-226591860 TTTCCTAGGCTGAAAGAGTGAGG + Intronic
1062906170 10:1180727-1180749 TTTCCAATGCAGCCAGAGTGAGG - Exonic
1063193976 10:3722960-3722982 GATCTAATGGTGAGAGAGTGAGG + Intergenic
1067228219 10:44389140-44389162 TCTTCAAAGCTGAGACAGTGGGG - Intergenic
1067690959 10:48502021-48502043 TTTTCATTGCTGAGAGAGTCAGG + Intronic
1069138815 10:64798835-64798857 ATTCCAATTCAGAGAGAGTGTGG + Intergenic
1070325726 10:75387746-75387768 TGTCCAATGGGGTGAGGGTGAGG + Intergenic
1070428978 10:76317090-76317112 GCTCCAATGCAGAGAGAGTGTGG + Intronic
1070566804 10:77609877-77609899 TGTCCACTGCTGACAGGCTGTGG - Intronic
1072126693 10:92451707-92451729 TGTCCTATGCTGGAAAAGTGAGG + Exonic
1073711516 10:106048259-106048281 TGTTCAATGCTGAGACTGTAGGG - Intergenic
1076888473 10:133273108-133273130 TGTCCAGTGCTGGGGGAGCGTGG + Intronic
1082047974 11:47746109-47746131 TGTCCAATCTGGAGAAAGTGAGG - Exonic
1083947826 11:65934954-65934976 TATCCAAGGCTGAGAGTGTAAGG - Intergenic
1088590730 11:111400418-111400440 TGTACAATACAGAGAGAGGGAGG - Intronic
1091869927 12:3880957-3880979 TTTCAAATGCTGAGAGAGTTAGG + Intergenic
1092035446 12:5330623-5330645 TGTTCAATGCTGTAAGGGTGAGG + Intergenic
1097361084 12:58658624-58658646 GCTCCAATGATGAGAGAGGGAGG + Intronic
1097510498 12:60532557-60532579 TGTGCTCTGATGAGAGAGTGAGG + Intergenic
1097808447 12:63991164-63991186 AATACAAAGCTGAGAGAGTGGGG - Intronic
1099922989 12:88982190-88982212 TGTTCAATGCTGGGGGAGAGAGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106215394 13:27693178-27693200 CATCAAATGCTGAGAGGGTGTGG - Intergenic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107838987 13:44436395-44436417 TGTCCATTGCTGAGAGATTATGG - Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108566113 13:51699678-51699700 TGTCCAATGCTGATAAGATGTGG + Intronic
1109367518 13:61375396-61375418 ACTGCAATGCTGAGAGACTGAGG - Intergenic
1109424426 13:62152274-62152296 TGCCCAATACTGAAAGAATGCGG + Intergenic
1110515521 13:76407998-76408020 TGTCACATGGCGAGAGAGTGAGG + Intergenic
1110965397 13:81688804-81688826 TGTCCCAGTCTGAGTGAGTGTGG + Intergenic
1114769194 14:25409439-25409461 TGAACAATGCTGAGTGAATGTGG - Intergenic
1115304148 14:31916653-31916675 TGTCCAGTGATAAGACAGTGAGG - Intergenic
1116181689 14:41543400-41543422 TTCCCAGTGCTCAGAGAGTGGGG + Intergenic
1116922651 14:50596627-50596649 TGTCCTATGATGACAGAATGAGG - Intronic
1117289345 14:54317379-54317401 TTAGCAATGCTGGGAGAGTGGGG - Intergenic
1118102869 14:62625964-62625986 TCTCCCATGCTGAGAGAAGGTGG + Intergenic
1121789543 14:96688755-96688777 TTTAAAATGTTGAGAGAGTGGGG - Intergenic
1123724315 15:23086973-23086995 TGTCCACTGTAGACAGAGTGAGG + Intergenic
1125098517 15:35882353-35882375 TGTTCAATGGTGAGTGACTGAGG - Intergenic
1126006805 15:44265762-44265784 TCTCCATTGCTGAGAGAGAGAGG + Intergenic
1127253303 15:57265369-57265391 TGTCCCAGTATGAGAGAGTGTGG + Intronic
1131782406 15:95873724-95873746 GGTCAAATGTAGAGAGAGTGAGG + Intergenic
1131875649 15:96803319-96803341 TGTTCAAAGCTGAGGGTGTGTGG + Intergenic
1132988556 16:2780779-2780801 TGTCCAGTGCTTAGTGTGTGGGG + Intergenic
1135195585 16:20391749-20391771 TAGCGAATGCTGAGAGAGAGAGG + Intronic
1140147995 16:72330853-72330875 TGTGCTATGCTCTGAGAGTGTGG + Intergenic
1140455174 16:75100790-75100812 TGTCCAAGACAAAGAGAGTGGGG + Intronic
1141948965 16:87328481-87328503 TGTCCACTGCTGAGTGTGAGTGG - Exonic
1144334740 17:14258526-14258548 TGAACAATGTTGAGAGAGTGGGG + Intergenic
1149883843 17:60320477-60320499 TGTCCCAGTCTGAGTGAGTGTGG - Intronic
1154346126 18:13545089-13545111 GGTCCTCAGCTGAGAGAGTGGGG + Intronic
1154350567 18:13579924-13579946 TGTCCGATGCTGTGAGAGCCAGG + Intronic
1158177761 18:54676989-54677011 TGTACATTGCTTAGAGGGTGAGG - Intergenic
1158525912 18:58213589-58213611 TGTGGAATGGTGGGAGAGTGGGG + Intronic
1158783029 18:60674902-60674924 TGGCCAAAGCTGAGACAGTCTGG + Intergenic
1159156908 18:64595805-64595827 TGTTGAAGGCTGAAAGAGTGAGG - Intergenic
1159932127 18:74323909-74323931 TGTCCCAGGCTGAGTAAGTGTGG + Intronic
1162839574 19:13346250-13346272 TGTCCAGTGGGGAGTGAGTGAGG - Intronic
1164717968 19:30407414-30407436 TGTCCACTGCTGGGTGTGTGGGG - Intronic
1166092028 19:40515491-40515513 TGTCCATGGCTGTGTGAGTGTGG - Intronic
1168455602 19:56505895-56505917 TGTCCCAGTCTGAGTGAGTGTGG + Intergenic
925593134 2:5529567-5529589 TTTCCATTGCTGAAGGAGTGAGG - Intergenic
926887926 2:17614568-17614590 TGGCCACAGCTGAGTGAGTGAGG - Intronic
926995331 2:18729245-18729267 TGTGCAATGAAAAGAGAGTGGGG - Intergenic
927455460 2:23245321-23245343 TGTCTAAAGCTGAGAGGGTCTGG - Intergenic
927464371 2:23325919-23325941 TCACCAATGCTCAGAGATTGTGG - Intergenic
932690452 2:73908587-73908609 ATTCCCATGCTGGGAGAGTGTGG - Intronic
932960351 2:76406295-76406317 TGCCCAATGCTGGCAGAGGGTGG - Intergenic
933048117 2:77564814-77564836 TGTCCGAGTCTGAGTGAGTGTGG - Intronic
934962587 2:98690142-98690164 TGGCCATTGCTGATAGAGTGGGG - Intronic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935207540 2:100909566-100909588 TGTCCAATGCTGAGGGCCCGGGG - Intronic
935418314 2:102841582-102841604 AGTCCAATGCTGTGAGCATGCGG + Intronic
935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG + Intergenic
937660216 2:124422120-124422142 TTGCCTATGCTGAGAGAATGAGG - Intronic
937845944 2:126578996-126579018 TGTACACTGCTGAGGGAGGGAGG - Intergenic
938261453 2:129898373-129898395 TGTCCATTACTGAGAGTGGGAGG - Intergenic
938315721 2:130326568-130326590 TGCCTGATGCTGAGAGAATGAGG + Intergenic
938442540 2:131348859-131348881 TGGACAATGATGAGAGAGAGTGG - Intronic
939728684 2:145754785-145754807 AGTCCACTGCTGTCAGAGTGAGG - Intergenic
941058683 2:160819379-160819401 TGTCAAATGCTGTGAAGGTGTGG - Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
942606438 2:177696547-177696569 TGTACAATTTTGATAGAGTGCGG + Intronic
943594691 2:189842189-189842211 TTTCCAATGTTGAGTGAGTATGG - Intronic
946015377 2:216599956-216599978 GGTCTAATGGTGAGAAAGTGGGG - Intergenic
1170213042 20:13864118-13864140 TGGCCATGGCTGAGAGATTGCGG + Intronic
1170351249 20:15444074-15444096 TGCCCAAGGTTGAGAGAGAGGGG - Intronic
1173100703 20:40085369-40085391 TGTCGAATGATGAGGAAGTGAGG - Intergenic
1173816631 20:45993530-45993552 TGTTCCTTGCTGAGCGAGTGAGG + Intergenic
1175151063 20:56934803-56934825 TGTCTAATGCTAAGATGGTGAGG + Intergenic
1177893804 21:26837905-26837927 TGACCCATGCTGAAAAAGTGGGG + Exonic
1183473034 22:38019583-38019605 TGCCCAAGGCAGAGAGAGGGAGG + Intronic
1183664835 22:39241329-39241351 TGGCCAGTGCTGGGAGAGTCAGG - Intronic
1183837047 22:40463191-40463213 TACCAAATGCTGAGAGAGAGAGG + Intronic
950143300 3:10630029-10630051 CGTCCAAGGCTGGGAGTGTGGGG + Intronic
950584719 3:13883990-13884012 TGTCCTGTCCTGTGAGAGTGTGG + Intergenic
950683209 3:14599457-14599479 TGCCCAGTGCTTAGGGAGTGTGG - Intergenic
952756026 3:36867994-36868016 TGTCCCAGTCTGAGTGAGTGCGG + Intronic
955375078 3:58387866-58387888 TGGAAAATGCTGAGGGAGTGGGG + Intronic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
957520038 3:81307683-81307705 TGTGCACTGCTGAAAGAGTTTGG - Intergenic
958004144 3:87791831-87791853 TCTCCAATGCTGAGAAAGGTGGG - Intergenic
958454249 3:94309543-94309565 TGTCCATTGCTTAGTGTGTGGGG + Intergenic
958526949 3:95273873-95273895 TTTCCAGTAGTGAGAGAGTGAGG + Intergenic
959104929 3:102054763-102054785 TGTCCTAGACTGAGTGAGTGTGG - Intergenic
960456770 3:117882042-117882064 TCTACACTGCTGAAAGAGTGAGG + Intergenic
962375145 3:134852904-134852926 TGCCCACTGCTGTGAGAATGTGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
965218744 3:165899225-165899247 TGCCCAATGTTGACAAAGTGAGG + Intergenic
965954983 3:174359123-174359145 AGTCCTCTGCTGTGAGAGTGAGG - Intergenic
967351437 3:188517982-188518004 TGTCATATGGTGAGAGAGAGCGG - Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969333655 4:6494354-6494376 GGTCCAATGTGGGGAGAGTGAGG - Intronic
969598854 4:8163868-8163890 TTTCCATTGCTGAGTGAGAGTGG - Intergenic
969691995 4:8708894-8708916 TGTCCCATCCTGAGAGGTTGAGG - Intergenic
970243883 4:14038324-14038346 TTTCTAATGGTCAGAGAGTGAGG + Intergenic
971447566 4:26767306-26767328 TATGCAATGCTGAGAAACTGTGG - Intergenic
971634417 4:29038131-29038153 TATCCAATGCAGAGAAACTGTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972591240 4:40489152-40489174 TGACCAATGCTGAAACAGTCAGG - Intronic
973601324 4:52545552-52545574 TGGCCAAATCTGAGACAGTGAGG - Intergenic
974337097 4:60563115-60563137 TGTAAAAGGCTGAGAGTGTGAGG + Intergenic
975086917 4:70352774-70352796 TGGCGGATGCTGAAAGAGTGAGG - Intergenic
977338836 4:95731291-95731313 TGCCCAATGCAGAGAGAGAAGGG - Intergenic
978853257 4:113363785-113363807 TATCCCATTCTGAGTGAGTGTGG + Intronic
979111654 4:116764722-116764744 TGTCCAATGCTGTCTAAGTGGGG - Intergenic
981844031 4:149145954-149145976 TGGCTAATGCTGAATGAGTGGGG + Intergenic
984081074 4:175250605-175250627 GGTCCAATGCTTAGGGATTGGGG + Intergenic
984599031 4:181705081-181705103 TGTCCAATGAGGAGAGAGATGGG - Intergenic
986458653 5:7945939-7945961 TGTACATTGCTGAGAGGTTGAGG - Intergenic
986503787 5:8429174-8429196 TCTCACATGCAGAGAGAGTGAGG + Intergenic
989112666 5:37922191-37922213 TGTCCCACCCTGAGAGATTGTGG + Intergenic
990926930 5:61036688-61036710 TTTCCAGTGCTGAAACAGTGAGG + Intronic
993615591 5:90107708-90107730 TCATCAATGCAGAGAGAGTGAGG + Intergenic
993638964 5:90379869-90379891 TTCCCATTCCTGAGAGAGTGGGG + Intergenic
993857760 5:93097259-93097281 TGTCCAATGCTTGGTGTGTGGGG - Intergenic
994059348 5:95456723-95456745 TCTCCAATGCAGAGAGGGTGGGG + Intergenic
996903487 5:128571603-128571625 TGTCCCATGTTGAGGGAGTGAGG - Intronic
997184021 5:131863369-131863391 TGTTGAGTGCTGAGTGAGTGGGG + Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000772130 5:165367971-165367993 TGTCCACTGCTCAGAGTGTGGGG - Intergenic
1004915969 6:20332386-20332408 TAGCCAAGGCTGGGAGAGTGAGG + Intergenic
1004995369 6:21186134-21186156 TGCCCACTGCTGAAAGATTGTGG + Intronic
1005564213 6:27073349-27073371 AGTCCCAGGCTGAGAGAGTCTGG - Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1014689149 6:124540691-124540713 TGTACAATGGTGAGAAAGTATGG + Intronic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1022467231 7:30660259-30660281 TGTACAATGCTGAGAAAGCCAGG - Intronic
1023733602 7:43215813-43215835 TGTCAAATGCTGAAGGAGTTAGG + Intronic
1024300115 7:47880754-47880776 TCTCCACTGCTCAGAGAGTATGG + Exonic
1025262092 7:57426297-57426319 TGGCCAAGGCTGAGAGACTCTGG + Intergenic
1031146619 7:118003949-118003971 TGTTAGATGCTGATAGAGTGGGG - Intergenic
1031832672 7:126646481-126646503 GTTTCAATGCTGAGAGAGGGAGG - Intronic
1032270303 7:130398916-130398938 TGACCACTGCTGAGGGAGCGGGG + Exonic
1033150964 7:138914570-138914592 TGTCCGTTAGTGAGAGAGTGTGG - Intronic
1035846319 8:2868688-2868710 TGACCCAAGCTCAGAGAGTGTGG - Intergenic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1036721173 8:11176930-11176952 TGGCCAATGCTAAGAGAAGGTGG + Intronic
1037629265 8:20638168-20638190 TACCCAATGTTGAGAGACTGGGG + Intergenic
1037657162 8:20894671-20894693 TCTCAAATGCTGAGAGACTTTGG - Intergenic
1038238721 8:25787949-25787971 AGTCCCATGCAGAGAGAATGAGG + Intergenic
1038316604 8:26489693-26489715 AGTCCCATTCTGAGAGACTGGGG - Intronic
1039120701 8:34143037-34143059 TGAAAAATTCTGAGAGAGTGTGG + Intergenic
1039637151 8:39179540-39179562 GGTCCAAAGCACAGAGAGTGTGG - Intronic
1040576689 8:48658682-48658704 TGGCCAATGCTGGGGGATTGTGG - Intergenic
1041530350 8:58858646-58858668 TGTCAAATGCTGACAGACAGGGG - Intronic
1041699883 8:60776515-60776537 TGTCCCAGGCTGAGAGAGAGGGG - Intronic
1042526388 8:69768927-69768949 TGTCCAAGGCTGAGGGAGGCAGG - Intronic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044541772 8:93416447-93416469 TGTCTCCTGCTGAGAGAGAGAGG - Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046164467 8:110413362-110413384 TGCCCAAGGCTGAGAAATTGTGG + Intergenic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1047074749 8:121388448-121388470 AGACCAAGGCTGAAAGAGTGTGG + Intergenic
1048167867 8:132079715-132079737 TACCCAAGGCTGGGAGAGTGTGG + Exonic
1048622665 8:136151996-136152018 TGTCCAAAGATGAGAGAGGCAGG + Intergenic
1048784922 8:138040300-138040322 TGTCCCAGTCTGAGTGAGTGTGG + Intergenic
1049047305 8:140163078-140163100 TCTCCAGAGCTGAAAGAGTGTGG - Intronic
1049521070 8:143091774-143091796 TGACCAAGGCTGAGAAAATGTGG - Intergenic
1052313834 9:27096229-27096251 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1055001251 9:71451256-71451278 TGTTCTATGCTGAGAGAAAGGGG - Intergenic
1060958394 9:127661244-127661266 TGTCTTATTCTGAGAGGGTGGGG + Intronic
1186301392 X:8203509-8203531 TGGCCAATGCCAAGAGATTGTGG + Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1194747348 X:97642506-97642528 TGGCTGATGCTCAGAGAGTGAGG - Intergenic
1195070512 X:101274577-101274599 TGTCCCAGTCTGAGTGAGTGTGG + Intronic
1195737059 X:108022909-108022931 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1197007106 X:121514863-121514885 TGACCAAAGCTGAAAGGGTGTGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1197819355 X:130529713-130529735 CATCCAAGGCTGAGGGAGTGAGG - Intergenic
1198767715 X:140095481-140095503 TGTCCAAAACTGAGACACTGGGG + Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199345501 X:146734044-146734066 TGTCATATGGTGAGAGAGAGAGG - Intergenic
1199780718 X:151056691-151056713 TGTCCCAGTCTGAGTGAGTGTGG + Intergenic
1201545771 Y:15160429-15160451 TGACCAATTGTGAGATAGTGAGG - Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic