ID: 1021297638

View in Genome Browser
Species Human (GRCh38)
Location 7:18928165-18928187
Sequence ATGCTGTAGTAGGTTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021297638_1021297641 -9 Left 1021297638 7:18928165-18928187 CCCTGTTCAACCTACTACAGCAT 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1021297641 7:18928179-18928201 CTACAGCATTAACTCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021297638 Original CRISPR ATGCTGTAGTAGGTTGAACA GGG (reversed) Intronic
904227174 1:29031717-29031739 AGGCTGTATTAGGTAGAACTAGG - Intronic
904356587 1:29944213-29944235 AGGCTGTTGTAGGTTGAATGCGG + Intergenic
905181610 1:36170874-36170896 ATGAAGAAGTCGGTTGAACAAGG + Intronic
908314666 1:62920976-62920998 ATACTGTGGTAGGTAGAAAAGGG + Intergenic
910753980 1:90666274-90666296 ATGATGTAGTAGGTTGCATTAGG - Intergenic
914720731 1:150286726-150286748 ATGCTGTAGTAGGTGGGACTGGG - Exonic
915065253 1:153219587-153219609 ATGCTGTAGTAGAAAGAACCTGG - Intergenic
916628542 1:166586649-166586671 CTGCTGTTATAGGTTGAAAATGG - Intergenic
924427941 1:243970905-243970927 AAGCTGGAGGAGGCTGAACAGGG - Intergenic
1064479916 10:15729281-15729303 ATACTGTAGCAGGTTGCAGAGGG + Intergenic
1068296634 10:55079952-55079974 AGGCTCTAGTAGGTAGAACAGGG + Intronic
1071311680 10:84348634-84348656 ATGATGGAGTAGGTTGAGGAGGG + Intronic
1074290287 10:112133191-112133213 ATCTTATAGTAGGTTGAATAGGG - Intergenic
1074488378 10:113913798-113913820 ATGCTGGAATAGGTTGACCATGG - Exonic
1075184710 10:120245340-120245362 ACTCTGTAGAAGGTTGAACTTGG + Intergenic
1078239756 11:9520444-9520466 AGGCTGTAGTACAATGAACATGG - Intronic
1078784559 11:14476096-14476118 ATAATGTAGTAGGTAGAATAGGG + Intronic
1082217345 11:49587954-49587976 ATGCTGTGGTAAGATGAGCAAGG + Intergenic
1084556480 11:69879129-69879151 ATGATGGAGGAGGTTGAGCAGGG + Intergenic
1086632208 11:89036180-89036202 ATGCTGTGGTAAGATGAGCAAGG - Intronic
1088092816 11:106063317-106063339 AAGCTTTTATAGGTTGAACATGG - Intronic
1088770013 11:113025063-113025085 ATGCTGTAGTCATTTGAAAATGG + Intronic
1088837146 11:113587348-113587370 ATGTTGTACTAGGCTGAACCAGG + Intergenic
1089188208 11:116635421-116635443 AAGCTGTGGTTGGTTAAACAGGG + Intergenic
1091179640 11:133592142-133592164 ATGCTGTAATGGGTTGCACTGGG - Intergenic
1091760542 12:3084437-3084459 ATGGTGTAGTCGGTGGAGCAGGG + Intronic
1097576378 12:61398238-61398260 ATTCTGTAGTGGGTTGAGTAAGG - Intergenic
1097739931 12:63229542-63229564 ATGTTGTAGAAGGGTGTACAAGG - Intergenic
1099501950 12:83424183-83424205 GTACTGTAGTGGATTGAACATGG - Intergenic
1101338228 12:103816135-103816157 AACCTGTAGTAGGTTGATTATGG - Intronic
1104891071 12:132140435-132140457 ATCCTGAAGCAGTTTGAACAGGG - Exonic
1109276444 13:60309130-60309152 ATGGTGCAATAGGTTGAAAAGGG - Intergenic
1112774712 13:102831671-102831693 ATGCTTTATTAGCTTTAACAGGG - Exonic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1120060879 14:79980610-79980632 ATGCTGAAGTACATTAAACAGGG - Intergenic
1120470945 14:84923694-84923716 ATGTTGTAATAGGTTTATCAAGG + Intergenic
1123674459 15:22695415-22695437 ATGCTGGAATTGGTTCAACAAGG - Intergenic
1123839531 15:24233901-24233923 ATGCTTTGGTAGGTTGAAGCAGG - Intergenic
1124326471 15:28768403-28768425 ATGCTGGAATTGGTTCAACAAGG - Intergenic
1126405262 15:48316573-48316595 ACACTGTAGTAGGCTGAACACGG + Intergenic
1131961612 15:97795195-97795217 ATGCTTTAGGAGGATGAACTTGG + Intergenic
1132635170 16:940701-940723 CAGCTGCAGTAGGTTTAACACGG - Intronic
1132877256 16:2145560-2145582 ATGCTGCAGTGGGTTAAAGATGG - Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1138225454 16:55290742-55290764 GTGCTGGAGGAGGTTGAAGATGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139167699 16:64588296-64588318 GAGCTTTAGTAGGCTGAACATGG - Intergenic
1153792467 18:8591899-8591921 ATGCTTTATCAGGTTGAAGAAGG - Intergenic
1156885700 18:42132874-42132896 ATTATATAGTAGGTTGGACATGG + Intergenic
1159707759 18:71714012-71714034 ATGCTGTAGTTGGATTAACTGGG - Intergenic
1163368839 19:16890635-16890657 AGGCTGTACTGGGTCGAACAGGG + Exonic
927356429 2:22178464-22178486 ATGGTAAAGTAGGTAGAACATGG + Intergenic
928909052 2:36400318-36400340 ATGATGTAGTTGATTGAAGAGGG + Intronic
941167060 2:162093844-162093866 TTGGTGTAGTAGATGGAACATGG + Intergenic
945005170 2:205397705-205397727 ATGCTTTAGGAGGTTGATGAGGG - Intronic
947770909 2:232669296-232669318 AAGCTGCAGGTGGTTGAACATGG + Intronic
1170598065 20:17820387-17820409 ATGCTGTGGTAGGTTAAAGATGG - Intergenic
1171165626 20:22967675-22967697 CAGCTGTAGTAGGGTGAAGAGGG - Intergenic
1173250546 20:41362194-41362216 ATGCTGTCTGAGGTTGGACATGG - Exonic
1175337112 20:58203846-58203868 ATGCTGTGGAAGGCTGAAAATGG + Intergenic
1177145307 21:17400884-17400906 AAGCTGTAGTAAGTTGGAAAAGG - Intergenic
955144305 3:56300814-56300836 ATGATGTCGTGGTTTGAACAGGG - Intronic
957631706 3:82724125-82724147 TTGCTGAAGTAGCTTGAACATGG + Intergenic
958618047 3:96521656-96521678 ATTCTGTGTTAGGTTGAAGAAGG - Intergenic
962220574 3:133561381-133561403 TTGCTGAAGTAGGTTAAAAATGG + Intergenic
963899607 3:150721439-150721461 CTGTTGTAATAGGTTGAAGATGG - Intergenic
965076265 3:163980718-163980740 TTGCTGTAGTAGGTTTAGAATGG + Intergenic
965449577 3:168820855-168820877 ATGCTGCAGCAGGATGAATATGG + Intergenic
966690609 3:182737737-182737759 AGGCTGAAGTAGCTTGAACTTGG + Intergenic
967363328 3:188656933-188656955 ATCATGTAGTAGGAAGAACAAGG - Intronic
968794729 4:2695195-2695217 ATTCTGTACTAGGTTGAATTCGG + Intronic
971818224 4:31518023-31518045 ATCCTGTAGTAGGAGGAAGATGG + Intergenic
972060014 4:34858045-34858067 ATGCTGTAATAGATTAAATATGG - Intergenic
972233060 4:37097722-37097744 ATTCTGTAGGAAGTTGAAGAGGG + Intergenic
974502184 4:62720732-62720754 ATTTTGTAGTAAGGTGAACATGG + Intergenic
974808699 4:66917196-66917218 ATGCTGGAGTAGGTTGCACTAGG - Intergenic
975115618 4:70677443-70677465 ATGCTTTAGCTGGCTGAACACGG + Intronic
982346481 4:154366053-154366075 ATGCTGAAGTATATTGAAAATGG - Intronic
983428685 4:167620079-167620101 AGGCTGTAGTAGGTAGGATAAGG + Intergenic
984073331 4:175144634-175144656 AGGCTGAAGCAGGTTGAACCTGG - Intergenic
984870553 4:184321217-184321239 ATGATGAAGTAGGTTGAGAAGGG + Intergenic
993910063 5:93670378-93670400 AGCCTGTAGCAGGTAGAACAAGG - Intronic
994013830 5:94941641-94941663 ATGCTGAAATAGGTTGCAAAGGG - Intronic
999573663 5:152949011-152949033 ATGCTGTGGTAGGTCAAAGATGG - Intergenic
1000696586 5:164393334-164393356 ATGCAGTAGTCGGGTGAAGAAGG + Intergenic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1001175947 5:169469056-169469078 GTGCAGTAGTAGGTGGCACAGGG - Intergenic
1004800482 6:19141409-19141431 TTGCTGTAGTCTTTTGAACAGGG - Intergenic
1006801299 6:36761330-36761352 ATGCTGAATGAGATTGAACATGG - Intronic
1012088494 6:94860062-94860084 CTAGTGTAGTAGGTTGAATAGGG - Intergenic
1017633146 6:156418826-156418848 ATGCTGTAGAAGTTTACACAAGG - Intergenic
1020433623 7:8138566-8138588 ATGCTGTAGTAGAAAAAACATGG - Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1024224159 7:47313034-47313056 ATGCAGTAGTAATTTGCACATGG - Intronic
1027929177 7:84508908-84508930 ATGCTGTAGAAAGTTGAATTTGG + Intergenic
1028918437 7:96285612-96285634 ATGCTGTAGGAGGTGGAAGGAGG - Intronic
1032656525 7:133936553-133936575 ATGCTGGAGGAGGTTGAAATAGG - Intronic
1034035101 7:147811386-147811408 ATACTGTAGTAGGCTGGGCATGG - Intronic
1035573201 8:687773-687795 AGGCCGTAGTAGGTGGAATACGG + Intronic
1037491107 8:19397838-19397860 CTGCTGCAGTAGGATGCACAAGG + Intergenic
1042500631 8:69504742-69504764 ATCCTGGAGTTGGTTGAAAAGGG - Intronic
1042864225 8:73343576-73343598 ATGCTGTAGTAGATGGAGAAGGG + Intergenic
1043272242 8:78349607-78349629 ATGCTTAAGTAAGTTGACCATGG - Intergenic
1049870825 8:144974380-144974402 ATGCTGTATCATGTTGCACAGGG - Intergenic
1052842053 9:33300351-33300373 AGGCTGTAACAGGTTGGACACGG - Intronic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1056742108 9:89266338-89266360 ATGGTGGAGTGGGTTTAACACGG - Intergenic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1189318207 X:40070572-40070594 TTGTTGAAGTAGGATGAACATGG - Intronic
1193485377 X:82080198-82080220 CTTCTGTAAGAGGTTGAACAAGG - Intergenic
1193520470 X:82523479-82523501 AAGTTGTAGTAGGTAGAACATGG + Intergenic
1196595790 X:117544069-117544091 ATGCTGTAGCAGGTGCACCAAGG - Intergenic