ID: 1021298577

View in Genome Browser
Species Human (GRCh38)
Location 7:18941184-18941206
Sequence AAGAATAACGGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1409
Summary {0: 1, 1: 0, 2: 3, 3: 119, 4: 1286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021298577 Original CRISPR AAGAATAACGGGAGGGAGGC AGG (reversed) Intronic
900017392 1:162190-162212 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
900047651 1:520786-520808 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
900932129 1:5744110-5744132 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932159 1:5744186-5744208 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932168 1:5744210-5744232 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932193 1:5744270-5744292 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901199001 1:7456187-7456209 AGGAAAAATGGGAGGGAGGGAGG + Intronic
901199030 1:7456275-7456297 AAGAAGAATGGGAGGGAGGAAGG + Intronic
901265402 1:7906505-7906527 AAGAAAAGAGGGAGGGAGGGAGG + Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901477792 1:9502953-9502975 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
901570482 1:10156058-10156080 AAGAATACCTGGGGGGAGGAGGG + Intronic
902030057 1:13415794-13415816 AAGAACAAAGGGAGGGAGGGAGG + Intronic
902088738 1:13884923-13884945 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
902219629 1:14956872-14956894 AGGAAGAACAGGAGGAAGGCTGG - Intronic
902395613 1:16130989-16131011 AAGAGAGATGGGAGGGAGGCTGG - Intronic
902553811 1:17235138-17235160 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
902628315 1:17689507-17689529 AAGAAGAGAGGGAGGGAGGGAGG - Intronic
902692554 1:18118874-18118896 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
902778986 1:18692555-18692577 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
902918271 1:19651666-19651688 AAGAAAAGAGGGAGGGAGGCAGG - Intronic
903156402 1:21446547-21446569 AGGAAGAAAGGGAGGGAGGGTGG - Intronic
903265729 1:22156899-22156921 AAGGAGAAAGGGAGGGAGGGAGG - Intergenic
903333574 1:22610050-22610072 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
904072999 1:27816507-27816529 AAGAAAGAAGGGACGGAGGCTGG + Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
905034681 1:34910048-34910070 AAGAATAAGGGGAGGAAAGATGG - Intronic
905076488 1:35276267-35276289 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
905197913 1:36295588-36295610 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
905390599 1:37633652-37633674 AAGAATTGCGGGCGGGGGGCGGG + Intronic
905506873 1:38486670-38486692 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
905788076 1:40773909-40773931 AAGATCATCGGGAGGGAGGACGG - Intergenic
906235676 1:44207230-44207252 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
906628784 1:47347147-47347169 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
906786104 1:48617549-48617571 GAGAATAGCAGGAAGGAGGCGGG - Intronic
906824917 1:48969097-48969119 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
907019732 1:51055167-51055189 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907858487 1:58327282-58327304 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
908218357 1:61978243-61978265 AAGAATAAAGGAAGGAAGGAGGG - Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
908582618 1:65531799-65531821 AAGAAGGAAGGGAGGAAGGCAGG - Intronic
908678313 1:66630897-66630919 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
909101467 1:71354563-71354585 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909791364 1:79681910-79681932 AAGAAGCAAGGGAGGGAGGGGGG + Intergenic
909987414 1:82178700-82178722 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
910184385 1:84521178-84521200 AAGAAGAACGGAAGGAAGGGAGG + Intergenic
910474886 1:87595818-87595840 AAGAAGAAAGGGAGGGAGGGAGG - Intergenic
910476596 1:87614458-87614480 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
910489470 1:87753043-87753065 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
910516066 1:88061420-88061442 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910778443 1:90899921-90899943 AAGAAAAAAGGAAGGGAGGGAGG + Intergenic
910848240 1:91624709-91624731 AAGAATGAAGGGTGGGAGGAGGG + Intergenic
911065981 1:93788971-93788993 AAAAATAAAGGAAGGGAGGGAGG - Intronic
911210990 1:95137717-95137739 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
911629820 1:100170692-100170714 AAGAAGAAAGGGATGGAGGGAGG - Intronic
911708558 1:101042917-101042939 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
911720247 1:101183005-101183027 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
912144877 1:106781205-106781227 AAGAACAAAGGTAGGGAGGGAGG + Intergenic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912723029 1:112035833-112035855 GAGAATAAAGGGAGGAAGGATGG - Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
913254431 1:116941057-116941079 AAGCACAAAGGGAGAGAGGCAGG - Intronic
913573135 1:120141533-120141555 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914294392 1:146306330-146306352 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
914555436 1:148757113-148757135 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
914751811 1:150539821-150539843 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
914896173 1:151675778-151675800 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
915271278 1:154755582-154755604 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
915905506 1:159873893-159873915 AAGCATAGAGGGAGGGAGGGAGG - Intronic
916105190 1:161424527-161424549 AAAGAAAAAGGGAGGGAGGCAGG - Intergenic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916611438 1:166395784-166395806 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
916861527 1:168811072-168811094 AAGAATAGTGGAAGGCAGGCAGG - Intergenic
916976583 1:170086755-170086777 AGGAAGAAAGGGAGGGAGGGGGG - Intergenic
917562039 1:176168495-176168517 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
917587426 1:176441907-176441929 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
918309235 1:183273903-183273925 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
918323739 1:183389864-183389886 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918665623 1:187146876-187146898 AAGAAAAAAGGGAGGGAGGAAGG - Intergenic
918790246 1:188815941-188815963 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
918807654 1:189070245-189070267 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
919263271 1:195226440-195226462 AAGAAAGAAGGGAGGGAAGCAGG + Intergenic
919274923 1:195401456-195401478 AAGAAAAAAGGAAGGGAGGAAGG + Intergenic
919479920 1:198075610-198075632 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
919509779 1:198447682-198447704 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
919780850 1:201220021-201220043 AAGAAGACAGGGAGGGAGGAAGG - Intronic
919780860 1:201220107-201220129 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
919780869 1:201220146-201220168 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
919884181 1:201920730-201920752 TAGAATAGGGGGTGGGAGGCTGG + Intronic
920023967 1:202978322-202978344 AAAAAAAAAAGGAGGGAGGCAGG + Intergenic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920222868 1:204416929-204416951 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
920420234 1:205828118-205828140 AAGAGTAAGGGGAGAGATGCAGG + Exonic
920881049 1:209880831-209880853 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
921058623 1:211563850-211563872 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
921477273 1:215627364-215627386 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
923063045 1:230494685-230494707 AAGGAAAAAGGGAGGGAGGGAGG + Intergenic
923250952 1:232179260-232179282 AAGAGAAAAGGGAGGGAGGGAGG + Intergenic
923300475 1:232635562-232635584 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
923327009 1:232888904-232888926 AAGGATAACGGGAGGGAGAAAGG - Intergenic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923650366 1:235867362-235867384 AGAAATAACGGGAAGGAGTCAGG + Intronic
923821451 1:237447845-237447867 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
923948153 1:238914377-238914399 AAGAAATGAGGGAGGGAGGCAGG - Intergenic
924041102 1:239984725-239984747 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924202567 1:241675070-241675092 AAGGATGAAGGGAGGGAGGCAGG - Intronic
924307035 1:242700341-242700363 AAGAACAAATGGAGGGAGGGAGG + Intergenic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924583739 1:245344084-245344106 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
924949797 1:248872134-248872156 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1063111423 10:3041041-3041063 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1063605760 10:7521537-7521559 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1063698004 10:8356441-8356463 AAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1063713125 10:8500065-8500087 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1063919089 10:10913884-10913906 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064308167 10:14187149-14187171 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1064483472 10:15762309-15762331 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1064497443 10:15927560-15927582 AATAATAAAGGTAGGGAGGATGG + Intergenic
1064688851 10:17893144-17893166 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1064895284 10:20228573-20228595 AAGAAAAAAGGCAGGAAGGCAGG + Intronic
1065732014 10:28718095-28718117 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1065809747 10:29430521-29430543 AGGAAGAACAGGAGGGAGGCAGG - Intergenic
1065867746 10:29928381-29928403 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
1066641754 10:37560952-37560974 AAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1066950210 10:42110559-42110581 AGGAAAAAAGGGAGGGAGGAAGG - Intergenic
1067241005 10:44493564-44493586 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067480411 10:46593156-46593178 GAAAATGACAGGAGGGAGGCAGG + Intronic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068201445 10:53788758-53788780 AAGAAGAAAGGGAGGAAGGAAGG + Intergenic
1068310439 10:55267099-55267121 AAGAATAAAGGAAGGCAGGGAGG + Intronic
1068343096 10:55734537-55734559 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1068450407 10:57178960-57178982 AAGAAAAGAGGGAGGGAGGAAGG + Intergenic
1068662488 10:59637069-59637091 AAGAAGAAAGGAAGGCAGGCAGG - Intergenic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1068819069 10:61352256-61352278 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1068830695 10:61491521-61491543 AGGAAGAAAGGGAGAGAGGCAGG + Intergenic
1069230912 10:66007713-66007735 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1069420663 10:68243616-68243638 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1069590878 10:69641141-69641163 AAGAAAGAAAGGAGGGAGGCAGG + Intergenic
1069679253 10:70272169-70272191 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070486985 10:76941093-76941115 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070515970 10:77206792-77206814 AGGAATAAAGGGAGGCAGGGAGG + Intronic
1070547896 10:77466913-77466935 AAGAAAAAAGGGAGGGAGGGGGG + Intronic
1071268994 10:83989888-83989910 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1071444353 10:85731850-85731872 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1071779122 10:88823266-88823288 AAGAATAAGGTAAGGGAGGGTGG - Exonic
1071919028 10:90328836-90328858 GAGAATAATGGGAGGAAGGTGGG - Intergenic
1071920814 10:90348036-90348058 CAGAATAGCAGGAGGCAGGCAGG + Intergenic
1072267618 10:93745615-93745637 CAGAATAACTGGGGCGAGGCAGG - Intergenic
1072309606 10:94141651-94141673 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1072717968 10:97764133-97764155 AACAATATCGGCAGGAAGGCAGG - Intergenic
1072723215 10:97793672-97793694 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1073005588 10:100321749-100321771 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1073119682 10:101113918-101113940 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1073140100 10:101241634-101241656 AAGAGCAACGGGACAGAGGCAGG + Intergenic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1073169348 10:101490244-101490266 AGGAAGGAAGGGAGGGAGGCAGG - Intronic
1073400624 10:103254237-103254259 AAGAAAAAAAGGAGGGAGGGAGG - Intergenic
1073448535 10:103595559-103595581 GAGAAAAAAGGGAGGGAGGGAGG - Exonic
1073484758 10:103809678-103809700 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1073744034 10:106445491-106445513 AGGAATAAAGGCAGGAAGGCAGG + Intergenic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1073778880 10:106815297-106815319 AGGAATAAAGGGAGGGAGAGAGG + Intronic
1074522523 10:114238482-114238504 AAGAATAATGGGAAGGAGCATGG + Intergenic
1074731832 10:116386520-116386542 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1075122718 10:119675920-119675942 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1075235434 10:120723290-120723312 AAGAATGAAGGGAGGGAGGGAGG + Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075552492 10:123402395-123402417 AGGAATCAAGGGAGGGAGGGAGG + Intergenic
1075572483 10:123556270-123556292 GAGAATGGCAGGAGGGAGGCTGG + Intergenic
1075718754 10:124572676-124572698 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1075931881 10:126304311-126304333 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1076054949 10:127364811-127364833 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1076376607 10:129992371-129992393 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1076558669 10:131346862-131346884 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558682 10:131346909-131346931 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558695 10:131346956-131346978 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558706 10:131347003-131347025 AGGAATGAAGGGAGGGAGGGAGG - Intergenic
1076973993 11:157418-157440 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1077094777 11:794659-794681 AAGGGAAACGGGAGGCAGGCGGG - Intronic
1077272198 11:1686671-1686693 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077272289 11:1686946-1686968 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077983968 11:7332113-7332135 AAGAAGAAAGGGAGGCAGGTGGG + Intronic
1078076033 11:8161663-8161685 AAGAATCTTGGGAGTGAGGCTGG + Intronic
1078488602 11:11747806-11747828 AAGAATGAAGGGAGGAAGGAAGG + Intergenic
1078526767 11:12107424-12107446 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1078716708 11:13846606-13846628 AAGTATAGAGGGAGGGAGGGAGG + Intergenic
1078740663 11:14063407-14063429 AAGAAAAAAGGAAGGGAGGAAGG - Intronic
1078826438 11:14935031-14935053 AACAATAACTTGAGGGAGGGAGG - Intronic
1079748550 11:24164495-24164517 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1079923411 11:26460411-26460433 AAGAAGAAAGGGGGGGGGGCGGG + Intronic
1080135030 11:28844600-28844622 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1080212442 11:29801929-29801951 AACAACAAAGGCAGGGAGGCAGG + Intergenic
1081114211 11:39177937-39177959 AAGGAAAGCGGGAGGGAGGATGG + Intergenic
1081415220 11:42806822-42806844 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1081639348 11:44742296-44742318 AGGAAAAAAGGGAGGGAGGGAGG - Intronic
1082105616 11:48218135-48218157 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1083123780 11:60542293-60542315 AAGAAGAAAGGGAGGAAGGGAGG + Intronic
1083225536 11:61282225-61282247 AAGAAAAACGGGAGGGTGGAAGG - Intronic
1083406846 11:62463482-62463504 AAGCAAGACGGGAGGGAGGCTGG - Intronic
1083559960 11:63665483-63665505 AAGAATAAAGGAAGGGAACCAGG + Intronic
1083767275 11:64847602-64847624 AAGAATCACGTGTGAGAGGCGGG - Intergenic
1084219919 11:67671534-67671556 AAAAAAAAGGGGGGGGAGGCAGG - Intronic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085478092 11:76800252-76800274 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1085551444 11:77376981-77377003 AAGAATCACATGAGGGAGCCAGG + Intronic
1085806701 11:79643198-79643220 AGAAATAACGGGAGGGGGGAAGG + Intergenic
1085847513 11:80083219-80083241 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1086026636 11:82301253-82301275 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1086048983 11:82566945-82566967 AAGATGAAAGGGAGGGAGGGAGG + Intergenic
1086073587 11:82825635-82825657 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1086174567 11:83874306-83874328 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1087669584 11:101089706-101089728 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1087997003 11:104821797-104821819 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1088438475 11:109841528-109841550 AAGGAAATAGGGAGGGAGGCAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088840971 11:113627364-113627386 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1089651966 11:119920422-119920444 AAGCACAAAGGGAGGCAGGCTGG - Intergenic
1089894499 11:121915845-121915867 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1089958741 11:122597205-122597227 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1089960787 11:122615532-122615554 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1090036488 11:123253920-123253942 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1090392739 11:126399991-126400013 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1090584388 11:128194670-128194692 AGGAAGAGCGGGAGGGAGGGAGG - Intergenic
1090634643 11:128683376-128683398 AAGAAGAAAAGGAGGGAGGGAGG + Intergenic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091116110 11:133015330-133015352 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1091288189 11:134420672-134420694 AAGAATGACGGCAGTGAGGATGG - Intergenic
1091404273 12:199161-199183 AGGAAGACAGGGAGGGAGGCAGG + Intronic
1092092273 12:5812711-5812733 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092162643 12:6324385-6324407 AAGAAGAACTGGAAGGAAGCAGG - Intronic
1092551115 12:9501279-9501301 AAGAAGGAAGGGAGGAAGGCAGG - Intergenic
1092552253 12:9515435-9515457 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1092736692 12:11589461-11589483 AAGAAGAAAGGGAGTGAGGCTGG - Intergenic
1092778594 12:11965060-11965082 AAGAAAGAAGGGACGGAGGCTGG - Intergenic
1092888555 12:12947548-12947570 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093235922 12:16608213-16608235 AAGAAAAGAGGGAGGGAGGGAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093475270 12:19547808-19547830 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1093796790 12:23322166-23322188 AAGAGAAAAGGGAGGGAGGGAGG - Intergenic
1094094614 12:26689445-26689467 AAAAAGAGAGGGAGGGAGGCAGG + Intronic
1094146149 12:27230521-27230543 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1094292186 12:28863820-28863842 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1094519866 12:31175176-31175198 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1094636700 12:32233505-32233527 GGGAAGAACGGGAGGGAGGGAGG - Intronic
1094654768 12:32409581-32409603 AAAAATTACTGGGGGGAGGCTGG - Intronic
1095173712 12:39065315-39065337 AAGAAAAAGGGGAGAAAGGCTGG - Intergenic
1095292649 12:40493184-40493206 AAGAATAAGGTGAGGGTGCCAGG + Intronic
1095998438 12:48109322-48109344 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1096529608 12:52234457-52234479 AAGGAGAACGTGAGGGAGGCGGG - Intronic
1096530168 12:52237401-52237423 AAGAGTAGGGGAAGGGAGGCAGG + Intronic
1096964104 12:55611373-55611395 AGGAATAAAGGGAGGGAGACAGG + Intergenic
1097250575 12:57630415-57630437 AAGAATGCTGGGAGGGAGGCAGG - Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097968221 12:65603795-65603817 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1097969377 12:65616137-65616159 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
1098104240 12:67052759-67052781 AAAAATGAAGGGAGGGAGGGAGG + Intergenic
1098177289 12:67805974-67805996 AAGAAGAGAGGGAGGGAGGGTGG - Intergenic
1099168747 12:79338661-79338683 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1099321678 12:81158653-81158675 AAGAATAACTGCAGGGAAACAGG - Intronic
1099652529 12:85446418-85446440 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099808439 12:87549355-87549377 AAGAAGAAAGGGAGGGACGGAGG + Intergenic
1100029679 12:90170897-90170919 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1100149587 12:91719937-91719959 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1100272907 12:93043499-93043521 AAGAAGGAAGGGAGGGAGGAGGG - Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100556142 12:95695911-95695933 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
1100643332 12:96503416-96503438 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1100762931 12:97829829-97829851 AAGGATAAAGGGAGGAAGGAAGG - Intergenic
1100877171 12:98974898-98974920 AAGAAAGAAGGGAGGGAGGTAGG - Intronic
1101225266 12:102681932-102681954 AAGAATGAAGGGAGGGAGGGAGG - Intergenic
1101743845 12:107522781-107522803 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1102419352 12:112791667-112791689 ATAAATCACGGGTGGGAGGCAGG + Exonic
1102450569 12:113038964-113038986 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1102508029 12:113396325-113396347 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1102520909 12:113477020-113477042 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1102520937 12:113477105-113477127 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1102526582 12:113516275-113516297 AAAAATAAAGGAAGGGAGGAAGG - Intergenic
1102537344 12:113591335-113591357 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1102697857 12:114814203-114814225 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1102729825 12:115098693-115098715 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1102754101 12:115322977-115322999 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1102832284 12:116014546-116014568 AAGAAGAAAGGCAGGGAGACTGG + Intronic
1102929546 12:116851757-116851779 AAGAAAGAAGGGAGGGAGGGAGG + Exonic
1103030185 12:117606540-117606562 AGGAAGAAAGGAAGGGAGGCAGG - Intronic
1103030226 12:117606683-117606705 AGGAAGAAAGGAAGGGAGGCAGG - Intronic
1103040345 12:117690028-117690050 AAGAATGAATGGAGGGAGGGAGG + Intronic
1103047492 12:117749423-117749445 AGAAATAACGAGAGGAAGGCAGG + Intronic
1103495318 12:121357588-121357610 AAGAATGGAGGGAGGGAGGGAGG + Intronic
1103688575 12:122752381-122752403 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1103958956 12:124595503-124595525 AAGAAGAAAGGGAGAGAGGGAGG + Intergenic
1104508825 12:129357263-129357285 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1104950428 12:132437488-132437510 AAGAAGGAAGGGAGGGAGGAGGG + Intergenic
1105001989 12:132696002-132696024 AAGAACAACATGAGGAAGGCCGG - Exonic
1105456818 13:20548627-20548649 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1105561026 13:21491036-21491058 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
1105763396 13:23533708-23533730 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1105844850 13:24285518-24285540 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
1106125026 13:26894226-26894248 AAGAAGAAAGGAAGGGAGGAGGG + Intergenic
1106248885 13:27969197-27969219 AGGAAGAAAGGGAGGGAGGGAGG - Exonic
1106262118 13:28076961-28076983 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1106947057 13:34840265-34840287 GAGAAAGAAGGGAGGGAGGCCGG + Intergenic
1107083307 13:36397943-36397965 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1107788503 13:43977832-43977854 AAGAAAAGAGGGAGGGAGGGGGG - Intergenic
1107878837 13:44815564-44815586 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1108817581 13:54310920-54310942 AAGGAGAGAGGGAGGGAGGCAGG + Intergenic
1108854639 13:54777277-54777299 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1109119465 13:58435982-58436004 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1109321563 13:60816631-60816653 AAGAAGGACGGAAGGGAGGGAGG - Intergenic
1109496618 13:63180269-63180291 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1109693493 13:65923659-65923681 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1109759662 13:66811574-66811596 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1109847615 13:68016411-68016433 AAGAATAAAAGGAGGGATGGGGG - Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110575349 13:77048765-77048787 AGGAATCACAGGAGGGAGGCGGG - Intronic
1110622821 13:77618165-77618187 AAGAAAAAAGGGAGGAAGGGAGG - Intronic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1110997103 13:82124174-82124196 AAGAATAATGGGAGGGTGGGGGG - Intergenic
1111048366 13:82846592-82846614 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1111084127 13:83351786-83351808 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1111246907 13:85551964-85551986 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1111452592 13:88438661-88438683 AGGAAAAAAGGGAGGGAGGGAGG + Intergenic
1111613890 13:90640234-90640256 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1112038163 13:95517026-95517048 AAGAAAAAAGGGAGAGAGGGAGG - Intronic
1112764606 13:102727550-102727572 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1112912023 13:104497932-104497954 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
1113110146 13:106814209-106814231 AAGAAAAGAGGGAGGGAGGGAGG + Intergenic
1114276041 14:21146000-21146022 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1114911156 14:27199512-27199534 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1115564221 14:34611485-34611507 AAAAAAAAAGGGGGGGAGGCCGG + Intronic
1116201958 14:41808429-41808451 AAGAATCGAGGGAGGGAGGGAGG + Intronic
1116252961 14:42510267-42510289 AAGAAAGACAGGAGGGAGGGAGG + Intergenic
1116624627 14:47248946-47248968 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1116966268 14:51018302-51018324 AAGAAAAAAGGGAGGGAGGAGGG - Intronic
1117211272 14:53502893-53502915 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
1117359534 14:54959422-54959444 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1117383892 14:55192264-55192286 AAAAAAAAGGGGAGGGGGGCTGG - Intergenic
1117458923 14:55925761-55925783 AAGAATAAAGGGGTGGAGGTGGG - Intergenic
1117472039 14:56056147-56056169 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1117499667 14:56339412-56339434 GAGAAAAACTGGTGGGAGGCAGG - Intergenic
1118225023 14:63890560-63890582 GAGAATGAGGGGAGGGAGACAGG + Intronic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1118663113 14:68037059-68037081 AAGGATAAAGGAAGGGAGGGAGG - Intronic
1118818340 14:69328278-69328300 AAGAAGCAAGGGAGGGAGGCAGG + Intronic
1119285446 14:73450496-73450518 AAGAATACTGGGAGCTAGGCTGG + Intronic
1119610850 14:76060813-76060835 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1119887006 14:78151772-78151794 AAGATTTATGGGTGGGAGGCAGG - Intergenic
1119996035 14:79254805-79254827 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1120290472 14:82563663-82563685 AAGAAGAGTGGGAGGGAGGCAGG + Intergenic
1120309360 14:82810728-82810750 AGGAAGGAAGGGAGGGAGGCAGG - Intergenic
1120309378 14:82810780-82810802 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120309420 14:82810908-82810930 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120309440 14:82810968-82810990 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1120395953 14:83966990-83967012 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1120416274 14:84221824-84221846 AAGAAAAGAGGGAGGGAGACAGG + Intergenic
1120443801 14:84567885-84567907 AAGAGTCACGGGATGGGGGCTGG + Intergenic
1120575232 14:86173857-86173879 AAGAAGCAAGGGAGGGAGGAAGG + Intergenic
1120673382 14:87389961-87389983 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1120873792 14:89360579-89360601 AAGAAGAAAGGGAGAGAGGGAGG + Intronic
1121077009 14:91077296-91077318 AAGAAGAAAGCGAGGGAGGAAGG + Intronic
1121183383 14:91946325-91946347 AAGAATAGCTGGGGGGAGGCAGG + Intronic
1121436028 14:93920473-93920495 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1121553676 14:94820562-94820584 AAGAATGAAGGGACTGAGGCTGG + Intergenic
1121618912 14:95332582-95332604 AAGAAGAAAGGGAGGGCGGAGGG - Intergenic
1121800240 14:96768802-96768824 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1121833655 14:97073096-97073118 AAGAAGAAAGGGAGGGAGAGAGG - Intergenic
1121856238 14:97272723-97272745 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1121916752 14:97842449-97842471 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1122002170 14:98667335-98667357 AAGAAAAAAGGGAGGGAAGAAGG - Intergenic
1122012158 14:98759178-98759200 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1122207053 14:100152907-100152929 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1122392538 14:101399998-101400020 AAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1123754135 15:23383594-23383616 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
1124168851 15:27354008-27354030 AAGAAAGAAGGGAGGGAGGAAGG + Intronic
1124469938 15:29975300-29975322 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1124618406 15:31259579-31259601 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1124781830 15:32643140-32643162 AAGTCTAACAGGAGGGAGTCAGG - Intronic
1125132581 15:36300895-36300917 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1125307432 15:38335326-38335348 AAGAATAATGGGACAAAGGCTGG + Intronic
1125791204 15:42367126-42367148 AAGAATTCTGTGAGGGAGGCCGG - Intronic
1126193435 15:45903513-45903535 AAGAAGAAAGGGAGGAAGGGAGG - Intergenic
1126279591 15:46929260-46929282 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1126321486 15:47428985-47429007 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1126851125 15:52797933-52797955 AATAAAAACGGGAAGGGGGCAGG + Intergenic
1127070978 15:55288601-55288623 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127660775 15:61098177-61098199 AAGGAGACAGGGAGGGAGGCAGG - Intronic
1128774563 15:70309748-70309770 AAGGAAAGAGGGAGGGAGGCAGG + Intergenic
1128942392 15:71799434-71799456 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129422289 15:75438385-75438407 AAAAAAAACGGGTGGGATGCTGG + Intronic
1129481939 15:75833383-75833405 AAAAAAAAAGGGAGGGGGGCGGG + Intergenic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129880962 15:79005754-79005776 AAAAATAAAGGGAGAGAGGAAGG - Intronic
1130680569 15:85992589-85992611 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1130720314 15:86380244-86380266 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1130993357 15:88889983-88890005 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1131449208 15:92525328-92525350 AGGAAGAAAGGGAGGCAGGCAGG - Intergenic
1131528016 15:93167836-93167858 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131528030 15:93167873-93167895 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131528046 15:93167914-93167936 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1131528067 15:93167979-93168001 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1131857149 15:96609797-96609819 AAGGAAAGAGGGAGGGAGGCAGG - Intergenic
1131901056 15:97088472-97088494 AAGAAAAACAAGAGGGAGGCAGG - Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1131945419 15:97615352-97615374 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132755884 16:1485154-1485176 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1133464580 16:6018191-6018213 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1133597103 16:7303851-7303873 AAGGATAGCGAGAGGGAGGGAGG - Intronic
1133725244 16:8531042-8531064 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1133739522 16:8640771-8640793 AAGATGGATGGGAGGGAGGCAGG + Intronic
1133964091 16:10518908-10518930 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
1133979721 16:10624140-10624162 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1134121725 16:11588586-11588608 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1134304463 16:13019871-13019893 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1134462242 16:14439413-14439435 AAGAAGACAGGGAGGGAGGGAGG + Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134689724 16:16183371-16183393 AAGAGTAGCGGGAGGGAGGGAGG - Intronic
1134748022 16:16602864-16602886 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1134859090 16:17545069-17545091 AAGAACAAAGGTTGGGAGGCAGG + Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1134997446 16:18750795-18750817 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1135000258 16:18771170-18771192 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1135037808 16:19092904-19092926 AAGAAAAGAGGGAGGGAGGAGGG - Intergenic
1135037823 16:19092978-19093000 AAGAAAAGAGGGAGGGAGGAGGG - Intergenic
1135532465 16:23266324-23266346 AAGGATTCCTGGAGGGAGGCTGG + Intergenic
1135541427 16:23333084-23333106 AAGAAGAAAGGGAGGAAGGAAGG + Intronic
1135543235 16:23348446-23348468 AGGAAAAAAGGGAGGGAGGGAGG + Intronic
1135568057 16:23527260-23527282 AGTAATAACTGAAGGGAGGCTGG - Intronic
1135628935 16:24021059-24021081 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1135708025 16:24691787-24691809 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1135826096 16:25730352-25730374 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1135913138 16:26579190-26579212 AGGAAGAAGGGGAGGGAGGGAGG - Intergenic
1136021177 16:27441078-27441100 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
1136413001 16:30087755-30087777 AGGAAGTACGGGAGGGAGCCAGG - Intronic
1136634816 16:31513977-31513999 AGGAAGGAAGGGAGGGAGGCAGG - Intergenic
1136698206 16:32105613-32105635 AAGAGGAAAGGGAGGGAGGAAGG + Intergenic
1136749430 16:32619909-32619931 AGGAATAAAGGGAGGAAGGGAGG - Intergenic
1136938439 16:34498747-34498769 AGGAAAAAAGGGAGGGAGGAAGG - Intergenic
1136961380 16:34849810-34849832 AGGAAAAAAGGGAGGGAGGAAGG + Intergenic
1137266501 16:46873402-46873424 AAGAACAAGGCGTGGGAGGCTGG - Intergenic
1137686978 16:50393134-50393156 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1137847166 16:51702002-51702024 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1138264170 16:55647547-55647569 AAGAAGAAACGGAGGGAGGGAGG + Intergenic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1138654466 16:58482736-58482758 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1138746866 16:59373368-59373390 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1138752519 16:59440801-59440823 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
1139956969 16:70697781-70697803 AGGAACCACAGGAGGGAGGCAGG + Intronic
1140814126 16:78604907-78604929 AAGAAGACAGGGAGGGAGGGAGG - Intronic
1140851605 16:78939800-78939822 AAGGATGACGGAAGGGAGGCAGG - Intronic
1141104320 16:81220756-81220778 AAGAAAAATGGGAGGAAGGTTGG + Intergenic
1141141744 16:81500826-81500848 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1141324124 16:83039585-83039607 AACAAGGAAGGGAGGGAGGCAGG - Intronic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1142446270 16:90140267-90140289 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1203051561 16_KI270728v1_random:879119-879141 AGGAATAAAGGGAGGAAGGGAGG - Intergenic
1142461235 17:95196-95218 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1142781335 17:2183275-2183297 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1143021288 17:3918215-3918237 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1143092699 17:4458434-4458456 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1143111012 17:4552823-4552845 AAAAATAAGGGGTGGGGGGCAGG - Intronic
1143182549 17:4992701-4992723 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1143224522 17:5289147-5289169 AAGAAGAAAGGGAGGGAGGAAGG - Intronic
1143805662 17:9424211-9424233 GAGAATAACAGCAGGGTGGCCGG + Intronic
1143869787 17:9949858-9949880 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
1144472443 17:15556753-15556775 AGGGATAAAGGCAGGGAGGCTGG - Intronic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144924033 17:18787935-18787957 AGGGATAAAGGCAGGGAGGCTGG + Intronic
1144993982 17:19254172-19254194 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1145051891 17:19668946-19668968 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1145751076 17:27355503-27355525 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1146059794 17:29598515-29598537 AAAGAGAAAGGGAGGGAGGCAGG - Intronic
1146086353 17:29833774-29833796 AAGGAGAAAGGGAGGGAGGGAGG - Intronic
1146086381 17:29833851-29833873 AAGGAGAAAGGGAGGGAGGGAGG - Intronic
1146299415 17:31676601-31676623 AAGAAAAATGGGAGGAAGGAGGG + Intergenic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1148014267 17:44510005-44510027 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1148160052 17:45444517-45444539 GAGAATTTCAGGAGGGAGGCTGG + Intronic
1148180689 17:45602452-45602474 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148180704 17:45602548-45602570 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148264155 17:46211238-46211260 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1148268199 17:46243378-46243400 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1148370390 17:47095359-47095381 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1148465627 17:47863477-47863499 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148801682 17:50231078-50231100 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1148860188 17:50600579-50600601 AGGAATAAAGGAAGAGAGGCAGG + Intronic
1148922452 17:51051054-51051076 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1149080685 17:52653106-52653128 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1149089280 17:52759041-52759063 AGGAAGGAAGGGAGGGAGGCAGG - Intergenic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149676244 17:58465141-58465163 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1149939374 17:60846754-60846776 AGGAATGAAGGGAGGGAGGCAGG - Intronic
1150365155 17:64576208-64576230 AAAAAGAGAGGGAGGGAGGCAGG + Intronic
1150410126 17:64935440-64935462 GAGAATTTCAGGAGGGAGGCTGG + Intergenic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1150918482 17:69459882-69459904 AAGAAGAAAGGGAGGGAGAAAGG - Intronic
1150918508 17:69459985-69460007 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1150984868 17:70184569-70184591 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1151360579 17:73586269-73586291 AAGAGCAACAGGAGGGAGGGAGG - Intronic
1151429460 17:74052664-74052686 AAGAAAGACGGGAGGGGAGCAGG - Intergenic
1152601938 17:81267479-81267501 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1152652844 17:81503861-81503883 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1153151456 18:2099476-2099498 AAGAAAAGAGGGAGGGAGGGAGG + Intergenic
1153274335 18:3353115-3353137 AAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1154024264 18:10692445-10692467 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1154024273 18:10692470-10692492 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1154200803 18:12298927-12298949 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1155140487 18:23040034-23040056 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140495 18:23040062-23040084 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140502 18:23040086-23040108 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155231673 18:23780338-23780360 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1155261529 18:24047602-24047624 AGAAATAAAGGGAGGGAGGAAGG - Intronic
1155334254 18:24748745-24748767 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1155762157 18:29582101-29582123 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1156017350 18:32561184-32561206 AGGAAGGAAGGGAGGGAGGCAGG - Intergenic
1156037507 18:32782411-32782433 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156037530 18:32782485-32782507 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156037544 18:32782526-32782548 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1156314684 18:35957579-35957601 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156314705 18:35957739-35957761 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156413412 18:36859524-36859546 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1156966909 18:43105491-43105513 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1157877978 18:51291510-51291532 AAGGAAAATGGGAGGGAGGGAGG - Intergenic
1158279294 18:55803529-55803551 AAAAAGAAAGGGAGGGAGGGAGG - Intergenic
1158544828 18:58387065-58387087 AAAAATAACGTGCTGGAGGCAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159313127 18:66736245-66736267 AAAAATAACGGAAGGAAGGAAGG - Intergenic
1159514042 18:69434921-69434943 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1159543890 18:69815175-69815197 AAGAAAGAAGGGAGGGAGGCGGG + Intronic
1159688866 18:71460047-71460069 AAGAATAAAGGAAGGCAGCCAGG - Intergenic
1159806122 18:72960364-72960386 AAGAAGGAAGGGAGGCAGGCAGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160544999 18:79647287-79647309 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1160650936 19:227563-227585 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1161052723 19:2173337-2173359 AAGCAACACAGGAGGGAGGCTGG - Intronic
1161139577 19:2639675-2639697 AAGGAGAGAGGGAGGGAGGCAGG + Intronic
1161197059 19:2992785-2992807 AAAAAAAAAGGGGGGGAGGCGGG + Intronic
1161621170 19:5298088-5298110 AAGAAAGACTGGAAGGAGGCCGG - Intronic
1161765790 19:6207862-6207884 AAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1162157809 19:8691528-8691550 AAGAAAAGAGGGAGGGAGGGAGG - Intergenic
1162171190 19:8790273-8790295 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1162204661 19:9046793-9046815 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1162857764 19:13482187-13482209 AAGAATAGCAGTAAGGAGGCCGG + Intronic
1162858921 19:13490906-13490928 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1162934534 19:13975052-13975074 AAAAAAAAAGGGAGGGGGGCAGG + Intronic
1163117391 19:15196667-15196689 AATAATAATGGTAGGGAGGCAGG - Intronic
1163207232 19:15812576-15812598 AAGAAAGGAGGGAGGGAGGCAGG + Intergenic
1163207248 19:15812642-15812664 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1163508444 19:17721523-17721545 AAAAATAACGGCATGGTGGCAGG + Intronic
1163560420 19:18016136-18016158 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1164714802 19:30383873-30383895 AAGAAGGAAGGGAGGGAGGGGGG - Intronic
1164714873 19:30384219-30384241 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1164714881 19:30384243-30384265 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1164744096 19:30598932-30598954 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1164772034 19:30816611-30816633 AAGAAGAAATGGAGGGAGGTAGG - Intergenic
1164794490 19:31015000-31015022 AAGGATAGCAGGAGGGAGGGAGG + Intergenic
1164802353 19:31088163-31088185 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1165189336 19:34049353-34049375 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1165332412 19:35148105-35148127 AAGAAAGAGGGGAGGGAGGGAGG + Intronic
1165527959 19:36372062-36372084 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1166142719 19:40813580-40813602 AAGAAAAAAGGAAGGGAGGGAGG - Intronic
1166709860 19:44929884-44929906 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1166932801 19:46311566-46311588 AAGACTAACGTTAGGCAGGCCGG + Intronic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167194276 19:48016431-48016453 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1167195154 19:48023327-48023349 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1167206504 19:48105934-48105956 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1167229107 19:48270595-48270617 AAGAAAGAAGGGAGGGAGGAAGG + Intronic
1167325779 19:48824439-48824461 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1167391696 19:49199553-49199575 TAAAAAAACGGGAGGGTGGCCGG - Intronic
1167554179 19:50183003-50183025 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1168143897 19:54408517-54408539 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168508764 19:56957960-56957982 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925434705 2:3826940-3826962 AAGAAGAGAGGGAGGGAGGCAGG - Intronic
925466473 2:4110924-4110946 AAGAAGAAAGGGAGGGAGGAAGG - Intergenic
925719550 2:6813754-6813776 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
925775859 2:7335127-7335149 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926809873 2:16746579-16746601 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
927254626 2:21029474-21029496 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
927524369 2:23723449-23723471 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
927532281 2:23818224-23818246 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
927782226 2:25948735-25948757 AGGAATGAAGGGAGGGAGGGAGG + Intronic
928159250 2:28906958-28906980 AAGAACAAATGGAGGGAGACAGG + Intronic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928259108 2:29750726-29750748 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
928963651 2:36955367-36955389 AAGAAAATCGAGAGGGAGGAGGG + Intronic
929092569 2:38233989-38234011 AATAATCAGTGGAGGGAGGCTGG - Intergenic
929154036 2:38773429-38773451 AAGAACGAAGGGAGGGAGGGAGG - Intronic
929172816 2:38948581-38948603 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
929334236 2:40721368-40721390 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
929336696 2:40756643-40756665 AGGAATGAAGGGAGGGAGGGAGG - Intergenic
929474516 2:42232571-42232593 AAGATTAACAGGAGTGAGGTGGG - Intronic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
929548153 2:42870079-42870101 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
929604620 2:43226400-43226422 ACGAATAACGGGCGAGGGGCGGG + Exonic
929606523 2:43238160-43238182 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
929712693 2:44281006-44281028 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
929851253 2:45592398-45592420 AAGAATCACGGGAAAGGGGCTGG + Intronic
929993297 2:46807705-46807727 AAGAAGAGAGGGAGGGAGGGAGG + Intergenic
930097827 2:47580397-47580419 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
930394439 2:50802623-50802645 AAGAAAGAAGGGAGGGAGGAGGG + Intronic
930443146 2:51434605-51434627 AAAAGTAAAGGGATGGAGGCTGG + Intergenic
931264665 2:60649957-60649979 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
931704032 2:64932158-64932180 AGGAAGAATGGGAGGCAGGCAGG - Intergenic
931730336 2:65147548-65147570 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
932238041 2:70136759-70136781 AAAAACAAGGGGTGGGAGGCAGG - Intergenic
932320699 2:70820226-70820248 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
932458086 2:71862402-71862424 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
932539376 2:72636290-72636312 AAGAAGGCAGGGAGGGAGGCAGG + Intronic
933069333 2:77837047-77837069 AAGAAGAGAGGGAGGGAGGGAGG + Intergenic
933337367 2:80975556-80975578 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
933362737 2:81308471-81308493 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
933431502 2:82185917-82185939 AAGAAAAAAGGAAGGGAGGAAGG + Intergenic
933553755 2:83807285-83807307 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
933708428 2:85308348-85308370 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
933894819 2:86801278-86801300 AGGAAGGAAGGGAGGGAGGCAGG - Intronic
933971326 2:87472172-87472194 AGGAATGAAGGGAGGGAGGGAGG - Intergenic
934050098 2:88202491-88202513 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934331855 2:92075512-92075534 AGGAAAAAAGGGAGGGAGGAAGG + Intergenic
934331863 2:92075542-92075564 AGGAAAAAAGGGAGGGAGGAAGG + Intergenic
934730158 2:96651390-96651412 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
934730165 2:96651427-96651449 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
934730175 2:96651472-96651494 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
935634294 2:105238000-105238022 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
935634301 2:105238020-105238042 AGGAATGGAGGGAGGGAGGCAGG + Intergenic
935731388 2:106066967-106066989 AAGAACAAAGAGTGGGAGGCAGG - Intronic
935737795 2:106120183-106120205 ATGAATAACGGGACGGAAGGTGG + Intronic
936259088 2:110942972-110942994 AAGAAGAGTGGGAGGGAGGGAGG + Intronic
936259107 2:110943078-110943100 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
936439142 2:112535001-112535023 AAGGAGAAAGGGAGGGAGGGAGG + Exonic
936499904 2:113058868-113058890 AGGAAGAAAGGGAGGGAGGCAGG + Intronic
936926568 2:117742966-117742988 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
937030406 2:118734321-118734343 AAGAATAAAGGAAGGAAGGGAGG + Intergenic
937368276 2:121280795-121280817 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
937575350 2:123413928-123413950 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
937685368 2:124690615-124690637 AGGAATAGCAGGAGAGAGGCTGG - Intronic
937714000 2:125011049-125011071 AGGAAGAGAGGGAGGGAGGCAGG + Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
939319907 2:140605672-140605694 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
939579369 2:143930169-143930191 AATATCAAAGGGAGGGAGGCTGG + Intergenic
939756493 2:146118928-146118950 AAAAATGAAGGGAGGGAGGAAGG + Intergenic
939758166 2:146138866-146138888 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
939784107 2:146487453-146487475 AAGGAAAAAGGGAGAGAGGCAGG + Intergenic
939825919 2:147015502-147015524 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
940372921 2:152922683-152922705 AAGAAGAAAGGGATGGAGGGAGG - Intergenic
940744667 2:157554361-157554383 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
941423717 2:165317349-165317371 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
941569221 2:167148494-167148516 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
942424209 2:175842085-175842107 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
943022240 2:182589250-182589272 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
943227890 2:185205021-185205043 AGGAACAAAGGGAGGGAGGGAGG - Intergenic
943330757 2:186556296-186556318 AGGAATAGAGGGAGGGAGGAAGG - Intergenic
944188589 2:196976898-196976920 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
944727285 2:202484347-202484369 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945197883 2:207254248-207254270 AAGAAAACCTGGAGGGAGGAAGG + Intergenic
945472190 2:210240002-210240024 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
945876060 2:215279701-215279723 AAGGAAAACGGGAGGAAGGGAGG + Intergenic
946254016 2:218430249-218430271 AAGGAGAAATGGAGGGAGGCTGG + Intronic
946371219 2:219282618-219282640 AAGAATAAAGGAAGGAAGGAGGG - Intronic
946485185 2:220094707-220094729 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946610991 2:221457763-221457785 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
946766052 2:223041984-223042006 AAGACAGACGGGAGGGAGGGAGG - Intergenic
946892883 2:224296496-224296518 AAGAAAAACTGTAGGTAGGCTGG - Intergenic
947037744 2:225878808-225878830 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
947094622 2:226551718-226551740 AAGCATAGCCAGAGGGAGGCAGG + Intergenic
947374574 2:229482615-229482637 AAGAATCATGAGAGGGATGCAGG + Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
948434907 2:237946457-237946479 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1168915531 20:1482582-1482604 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1169009791 20:2241037-2241059 AAGAAAAAAGGAAGGGAGGGAGG - Intergenic
1169091502 20:2863838-2863860 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1169202855 20:3722127-3722149 AAGACGAACTGGAAGGAGGCAGG - Intergenic
1169246393 20:4028382-4028404 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169530994 20:6484946-6484968 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1170113184 20:12827509-12827531 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1170407362 20:16052435-16052457 AAGAGTTACAGGAGGGAGGGAGG + Exonic
1170415215 20:16132447-16132469 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1170451235 20:16486299-16486321 AGGGATAAAGGGAGGGAAGCTGG + Intronic
1170501842 20:16982538-16982560 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1170938225 20:20827825-20827847 AAGAAGGAAGGGAGGGAGGGGGG + Intergenic
1171151935 20:22834986-22835008 AAGAATAGAGGGAGGGAGAGAGG - Intergenic
1171190381 20:23154983-23155005 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1171199018 20:23226243-23226265 AAGAATGAAGGGAGGAAGGGAGG + Intergenic
1172021099 20:31914664-31914686 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
1172153031 20:32803917-32803939 GACAATAACAGGATGGAGGCGGG + Intronic
1172756093 20:37285554-37285576 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173198695 20:40938077-40938099 AAAAATAAAGGGGGCGAGGCGGG + Intergenic
1173248018 20:41349550-41349572 AAGAAGGATGGGAGGGAGGAAGG - Intronic
1173444664 20:43106706-43106728 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1173484872 20:43433597-43433619 AAGAAAGAAGGGAGGGAGGAAGG + Intergenic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1174140819 20:48412500-48412522 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1174140841 20:48412590-48412612 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1174285422 20:49469301-49469323 AAGTAGAAAGGGAGGGAGACAGG - Intronic
1174445511 20:50588198-50588220 AAGGAGAGCGTGAGGGAGGCAGG - Intronic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1174701238 20:52611246-52611268 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1174742768 20:53031908-53031930 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1174763545 20:53230038-53230060 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1174829968 20:53803587-53803609 AGGAATGAAGGGAGGGAGGGAGG - Intergenic
1174913465 20:54631469-54631491 AAGGAGAGAGGGAGGGAGGCAGG + Intronic
1175059633 20:56230378-56230400 AAGAAAAAAGGGAGGGAGGGAGG + Intergenic
1175100252 20:56574348-56574370 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1175125012 20:56744877-56744899 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1175205864 20:57310658-57310680 AAGAATTAAGGGAGGCAGCCAGG - Intergenic
1175287703 20:57848753-57848775 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
1175384379 20:58584812-58584834 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1175426660 20:58871710-58871732 AAGAAGGAAGGGAGGGAGGAGGG + Intronic
1175479999 20:59304023-59304045 AAGAAAGAAAGGAGGGAGGCAGG - Intronic
1176551621 21:8225282-8225304 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1176570530 21:8408281-8408303 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1176578439 21:8452448-8452470 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1177234203 21:18365520-18365542 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1177235856 21:18389215-18389237 AAGAAAGGAGGGAGGGAGGCAGG + Intronic
1177344240 21:19848334-19848356 AAGAATGATGGGAGTGTGGCAGG - Intergenic
1177635839 21:23785310-23785332 AGGAATGAAGGGAGGGAGGGAGG + Intergenic
1177637510 21:23806660-23806682 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1177642959 21:23867712-23867734 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1177736517 21:25097576-25097598 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1177788991 21:25701432-25701454 AAGAAGAGAGGGAGGGAGGGAGG - Intronic
1178042274 21:28652451-28652473 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178531817 21:33382268-33382290 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1178534783 21:33402966-33402988 AAAAAAAAGGGGAGGGGGGCGGG + Exonic
1178909274 21:36661210-36661232 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1178920778 21:36736752-36736774 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1178920786 21:36736811-36736833 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1179116711 21:38499855-38499877 AAGGAGAAAGGGAGGGAGGGAGG + Intronic
1179388907 21:40969724-40969746 AGGAAGAACGGAAGGGAGGAAGG + Intergenic
1179986594 21:44925401-44925423 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1180872193 22:19152568-19152590 AAAAAAAAAGGGAGGGGGGCAGG - Intergenic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181464494 22:23103573-23103595 AGGAAGAGCGGGAGGGAGGCAGG - Intronic
1181860887 22:25817402-25817424 AAGAAAAGAGGGAGGGAGGAAGG - Intronic
1181933797 22:26425682-26425704 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1182693978 22:32184030-32184052 AGGAATAACTGGCGGGGGGCGGG + Intergenic
1182931438 22:34178199-34178221 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183239142 22:36643024-36643046 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1183764831 22:39863205-39863227 AAGAATATAGGAAGGCAGGCAGG + Intronic
1184013012 22:41763551-41763573 AAGAAAATCGGGACTGAGGCTGG + Intronic
1184405050 22:44296144-44296166 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
1184472944 22:44706093-44706115 AAGAGAAAGGGGAGGGAGCCTGG - Intronic
1184892181 22:47386923-47386945 AAGAAAAACGGGACAGAGCCAGG + Intergenic
1185006807 22:48282835-48282857 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
1185132926 22:49050433-49050455 AAAAGGAAAGGGAGGGAGGCCGG - Intergenic
1203237737 22_KI270732v1_random:22021-22043 AGGAAGAACAGGAGGGAGGGAGG + Intergenic
1203256643 22_KI270733v1_random:142202-142224 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
950284230 3:11732279-11732301 AAGAAGAAAGGGAGGAAGGCAGG - Intergenic
950635539 3:14311762-14311784 AAGAATGAAGGAAGGGAGGGAGG - Intergenic
950784301 3:15421068-15421090 AAGAAGAACGGGTGGAAGGAAGG + Intronic
951158837 3:19390380-19390402 AAGAAGAAAGGAAGGGAGACAGG - Intronic
951282576 3:20770932-20770954 AAGAATAAAGGAAGGAAGGAAGG + Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
953027855 3:39154885-39154907 AAGAACAACAGGAGGAAAGCAGG + Intergenic
953062474 3:39438634-39438656 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
953360361 3:42290456-42290478 AAGAAGAAAGGGAGGGAGGGAGG - Intergenic
953737498 3:45508887-45508909 AAGAAGGAAGGGAGGGAGGCAGG - Intronic
953943073 3:47119515-47119537 AAGAATAACACGAGAAAGGCCGG - Intronic
953973928 3:47368513-47368535 AAGAAAAAAGGAAGGAAGGCAGG - Intergenic
954013330 3:47663091-47663113 AAGAAAAGAGGGAGGGAGGGAGG + Intronic
954155967 3:48685184-48685206 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
955065465 3:55530385-55530407 AACAAAAACAGGAGGCAGGCTGG + Intronic
955874545 3:63476073-63476095 AAGAATAGAGGAAGGGAGGGAGG + Intronic
955984266 3:64556749-64556771 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
956525905 3:70160362-70160384 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
956767547 3:72496630-72496652 AAGAATGAAGGGAGGAAGGGAGG - Intergenic
956873818 3:73442970-73442992 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
956961754 3:74411031-74411053 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
956968238 3:74489414-74489436 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
957467099 3:80608159-80608181 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
957500127 3:81045233-81045255 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
957751656 3:84426582-84426604 AAGAAAAATAGGATGGAGGCTGG + Intergenic
958005263 3:87802161-87802183 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
958144897 3:89612158-89612180 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
958182431 3:90077164-90077186 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
958479460 3:94628169-94628191 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
958484534 3:94687187-94687209 AAGAATAAGGCTAGGGAGGGAGG - Intergenic
959205223 3:103298400-103298422 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
959416187 3:106078793-106078815 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
960286827 3:115839217-115839239 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960770017 3:121183659-121183681 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
960822203 3:121746774-121746796 AAGAATAAAGTGAGTTAGGCCGG - Intronic
961320988 3:126075457-126075479 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
961340119 3:126212273-126212295 AAGAAGAAAGGAAGGGAGGAAGG + Intergenic
962340118 3:134575376-134575398 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
962340139 3:134575480-134575502 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
962340158 3:134575580-134575602 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
962416062 3:135183231-135183253 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
962567265 3:136674108-136674130 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
963297551 3:143562389-143562411 AAGAGCAAAGGGAGAGAGGCAGG + Intronic
963429451 3:145179774-145179796 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
963583733 3:147158550-147158572 AAGAAAGAAGGGAGGGAGGAAGG + Intergenic
963928010 3:150972002-150972024 AGGAATAATGGGAGGGAGTGGGG + Intronic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964040209 3:152252280-152252302 AGGAACAAAGGGAGGGAGGGAGG - Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964246853 3:154663794-154663816 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
964382876 3:156115291-156115313 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
964434750 3:156639943-156639965 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
964592075 3:158376156-158376178 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
964779054 3:160315046-160315068 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
965039084 3:163482938-163482960 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
965165677 3:165192902-165192924 AGGAAGCACAGGAGGGAGGCAGG + Intronic
965211659 3:165797360-165797382 AAGAATAAAGGAAGGAAGGAAGG - Intronic
965775683 3:172228187-172228209 AAGAATCACTGGAGGGAGAAAGG + Intronic
965851250 3:173028002-173028024 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
966017459 3:175159788-175159810 AGGAAGGATGGGAGGGAGGCAGG - Intronic
966177334 3:177152585-177152607 AAGAAAAAGGGTAGGGCGGCCGG - Intronic
966215742 3:177500390-177500412 AAGAGTCACGGGATGGAGACTGG + Intergenic
966273823 3:178141373-178141395 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
967191294 3:186987139-186987161 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
967543054 3:190691391-190691413 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
968339337 3:197941546-197941568 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
968366894 3:198192424-198192446 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
968633548 4:1665820-1665842 ATGAAGAATGGGAGGGAGGGAGG + Intronic
969143528 4:5100578-5100600 AAGGAAGAAGGGAGGGAGGCAGG - Intronic
969207188 4:5655776-5655798 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
969270326 4:6095182-6095204 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
969405660 4:6989791-6989813 AAGAAAAAAGGCAGGGAGGCAGG - Intronic
969459414 4:7320891-7320913 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
969470857 4:7388526-7388548 AGGGATAACAGGAGGGAGACTGG - Intronic
969586142 4:8094920-8094942 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
969663619 4:8544645-8544667 AAGAATAGAAGGAGTGAGGCCGG + Intergenic
969827668 4:9770773-9770795 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
969854294 4:9986593-9986615 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
969861563 4:10039872-10039894 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
969864633 4:10066546-10066568 AAGAAGAAAGGGAGGGAGGTAGG + Intergenic
970690352 4:18612688-18612710 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
970690360 4:18612712-18612734 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
970697978 4:18699660-18699682 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
970792650 4:19876787-19876809 AAGAAAAGTGGGAGGGAGGAAGG + Intergenic
971037160 4:22706189-22706211 AAGAATAAAGTGTGTGAGGCCGG + Intergenic
971125706 4:23751806-23751828 AAGAATATAGGGAGAGAGGTGGG - Intergenic
971174274 4:24265865-24265887 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
971216117 4:24663681-24663703 AAGAAATAAGGGAGGGAGGAGGG - Intergenic
971364516 4:25967004-25967026 AAGAATAACTGGAGAAAGGCCGG - Intergenic
971487532 4:27175709-27175731 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
971563095 4:28106247-28106269 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
971717159 4:30193560-30193582 AGGAAGAAAGGGAGGGAGGTAGG - Intergenic
971769593 4:30879162-30879184 AGGAATAAAGGGAGGGAGGGAGG - Intronic
972004527 4:34083160-34083182 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
972017637 4:34266157-34266179 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
972185574 4:36523876-36523898 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
972353071 4:38255086-38255108 AAGAATAAAGGAAGGGATGGAGG + Intergenic
972598929 4:40554761-40554783 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
972629222 4:40828973-40828995 AAGAATTGTGGGAGTGAGGCTGG + Intronic
972648230 4:40990510-40990532 AAGGAGAAAGGGAGGAAGGCAGG + Intronic
972874682 4:43343713-43343735 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
972889731 4:43542275-43542297 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
973614676 4:52666424-52666446 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
973739057 4:53901819-53901841 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
973744697 4:53951700-53951722 AGGAATGAAGGGTGGGAGGCAGG + Intronic
973765367 4:54157165-54157187 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
973765386 4:54157210-54157232 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
974374830 4:61062297-61062319 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
975319162 4:72990476-72990498 AGGCATAAAGGAAGGGAGGCAGG + Intergenic
975430206 4:74281006-74281028 AAGAAAAAAGGGAGGAAGGGAGG - Intronic
975604248 4:76137370-76137392 AAGAATGGAGGGAGGGAGGAAGG + Intronic
975851611 4:78578372-78578394 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976810248 4:89092416-89092438 AGGAAGGACGGGAGGGAGGGAGG + Intronic
976967014 4:91055787-91055809 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977221304 4:94340637-94340659 AAAAAAAAAGGGAGGGGGGCGGG - Intronic
977271828 4:94926124-94926146 AGGAAGAAAAGGAGGGAGGCAGG - Intronic
977287691 4:95129387-95129409 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
977851273 4:101832851-101832873 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
978071643 4:104479826-104479848 AGGAATAAAGGGAGAGAGGGAGG - Intronic
978278922 4:106985936-106985958 AAGAAGAAAGGAAGGGAGGAAGG + Intronic
978286713 4:107086410-107086432 AAGAATGGAGGGAGGGAGGAAGG + Intronic
978443939 4:108762987-108763009 AGGGATAACGGGAGGAAGGCCGG - Exonic
979133707 4:117082173-117082195 AAGAATAAAGGGAAAGATGCTGG - Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979473155 4:121124680-121124702 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
979610947 4:122688251-122688273 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
980038677 4:127914251-127914273 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
980067240 4:128203330-128203352 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
980121336 4:128731323-128731345 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
980196532 4:129596134-129596156 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
980221135 4:129917444-129917466 AAGAATATAAGGAGGGAGGATGG + Intergenic
980510860 4:133785766-133785788 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
980510867 4:133785790-133785812 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
980616178 4:135228939-135228961 AGGAAGGAAGGGAGGGAGGCTGG - Intergenic
980727597 4:136785569-136785591 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
980846270 4:138329289-138329311 AGGAATGAAGGGAGGGAGGGAGG + Intergenic
980846277 4:138329313-138329335 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
980928704 4:139164252-139164274 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
981092269 4:140744107-140744129 AATAATAATGGGATGGAGGTGGG + Intronic
981094298 4:140762644-140762666 AAGAAGACAGGGAGGGAGGGAGG - Intergenic
981550443 4:145937190-145937212 AAGAAAAGCCGGAGGGAGGGCGG + Intronic
981676620 4:147350251-147350273 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
981736877 4:147962664-147962686 AAAAATAAAGGGAGTGAGGTAGG - Intronic
982052724 4:151518650-151518672 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
982223123 4:153141624-153141646 AGGAATGAAGGGAGGGAGGGAGG - Intergenic
982596728 4:157395046-157395068 AAGAAAGATGGGAGGGAGGGAGG + Intergenic
982708643 4:158737463-158737485 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
982884917 4:160766415-160766437 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
983310254 4:166051266-166051288 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
983390263 4:167122030-167122052 AGGAAGGAAGGGAGGGAGGCAGG - Intronic
983575414 4:169256237-169256259 AGGAAGAAAGGGAGGGAGGCAGG + Intronic
983640810 4:169942496-169942518 AAGAAGAACGTGAGGTAGGCCGG - Intergenic
983689412 4:170450422-170450444 AAGAGTAATGGGAGGCAGGGTGG - Intergenic
983850918 4:172579848-172579870 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
984224978 4:177023683-177023705 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
984255967 4:177390417-177390439 AAGAAGAAAGGGAGGAAGGGAGG - Intergenic
984416531 4:179467277-179467299 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
984612332 4:181855840-181855862 AAGAAGAGAGGGAGGGAGGGAGG + Intergenic
984635049 4:182101345-182101367 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
984762851 4:183377377-183377399 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
984837104 4:184032470-184032492 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
985106936 4:186509333-186509355 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
985177336 4:187215569-187215591 AATAAGAAAGGGATGGAGGCCGG - Intergenic
985238062 4:187898513-187898535 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985333537 4:188867861-188867883 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
985746224 5:1649721-1649743 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
986052579 5:4104047-4104069 AAGAATAATGTGAGGGAGTTGGG - Intergenic
986054216 5:4119805-4119827 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
986313613 5:6571831-6571853 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
986463041 5:7992916-7992938 AAGGAGAAAAGGAGGGAGGCAGG + Intergenic
986714482 5:10512908-10512930 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
987385929 5:17329380-17329402 AAGAAAAAAGGGAGGGAGGAGGG - Intergenic
987563119 5:19549811-19549833 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
987738952 5:21880502-21880524 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988330768 5:29836963-29836985 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
988475219 5:31578678-31578700 AAGAAAGGTGGGAGGGAGGCAGG + Intergenic
988699966 5:33663431-33663453 AAGAAAAAAAGGAGGGAGGAAGG + Intronic
989103235 5:37839312-37839334 AAGTAGAACCGGAGAGAGGCCGG - Intronic
989440984 5:41471986-41472008 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
990042191 5:51388846-51388868 TAAAATACCGAGAGGGAGGCGGG + Intronic
990108698 5:52295731-52295753 AAGAAGAAAGGGAGGAAGGAAGG - Intergenic
990136880 5:52655987-52656009 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
990485609 5:56257072-56257094 AGGAATGAAGGAAGGGAGGCAGG - Intergenic
990797197 5:59556888-59556910 AGGAAGAAAGGGAGGGTGGCAGG + Intronic
991005414 5:61823531-61823553 AAGAACAAAGGTAGGAAGGCAGG + Intergenic
991517532 5:67455270-67455292 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
991597573 5:68321302-68321324 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
991900306 5:71454003-71454025 GAAAGTAATGGGAGGGAGGCTGG - Intergenic
992006099 5:72478971-72478993 AGGAAAACAGGGAGGGAGGCAGG - Intronic
992183994 5:74225912-74225934 AGGAAAAAAGGGAGGGAGGAAGG - Intergenic
992519997 5:77540716-77540738 AAGAATGTAGGGAGGGAGGGAGG + Intronic
993282651 5:85946399-85946421 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
993375075 5:87141134-87141156 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
993417433 5:87652769-87652791 AAGAAATAAGGGAGGGAGGGAGG - Intergenic
993969368 5:94398012-94398034 AGGAAGAACGGGAGGGAGGAGGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
995076030 5:107983848-107983870 AATAATAGAGGGAGGGAGACAGG + Intronic
995083369 5:108079972-108079994 AAGAATTAAGGCAGGGAGGCAGG + Intronic
995314629 5:110754502-110754524 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
996292719 5:121872629-121872651 AAAAAAAATGGGAGGGAGGAGGG - Intergenic
996560119 5:124819528-124819550 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
996577983 5:124997708-124997730 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
996734793 5:126748743-126748765 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
996856484 5:128013752-128013774 AAGAATAAAGGTGGGGAGGAGGG + Intergenic
996924809 5:128811896-128811918 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
997511911 5:134459982-134460004 AAAAAAAACGGGAAGGGGGCTGG + Intergenic
997963404 5:138338806-138338828 AAGAAAAACATGAGGAAGGCAGG - Intronic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998637633 5:143973504-143973526 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
998704347 5:144741288-144741310 AAGAAGGGAGGGAGGGAGGCAGG - Intergenic
999237374 5:150106995-150107017 AAGAAGACCGGAAGGGAGACTGG - Intronic
999751640 5:154632104-154632126 AGGAAGAGCGGGAGGGAGGGAGG - Intergenic
1000277842 5:159754739-159754761 TAGAATAACTAGAGGGATGCAGG + Intergenic
1000297445 5:159924445-159924467 GAGGAAAACGGGAGGGAGGAAGG + Intronic
1000364988 5:160482164-160482186 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1000445581 5:161314706-161314728 AAGAACAAAGGGAGGAAGGAAGG - Intronic
1000485590 5:161839527-161839549 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1000499283 5:162028734-162028756 AAGAAAAATGGGAGGAAGGGAGG + Intergenic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1000690908 5:164319751-164319773 ATGTATAAAAGGAGGGAGGCAGG - Intergenic
1000763415 5:165254810-165254832 AATAATAAAGGGAGGAAGGAAGG - Intergenic
1000808604 5:165831288-165831310 ATGAAAAAAGGCAGGGAGGCAGG - Intergenic
1000992911 5:167929132-167929154 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1001201350 5:169720449-169720471 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1001234217 5:170015809-170015831 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1001234224 5:170015834-170015856 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002048571 5:176556025-176556047 GGGAATCATGGGAGGGAGGCAGG - Intronic
1002130935 5:177081257-177081279 AAGAAGAGGGGGAGGGAGGGAGG + Intergenic
1002255420 5:177954751-177954773 AAGAAGAAAGGGAGGGAGGAGGG + Intergenic
1002257324 5:177967742-177967764 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1002482624 5:179513315-179513337 AGGAAGAAAGGGAGGGAGGGGGG - Intergenic
1002516071 5:179759959-179759981 AGGAGGAGCGGGAGGGAGGCTGG + Intronic
1002726118 5:181297622-181297644 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1002854872 6:1027668-1027690 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1002913853 6:1512517-1512539 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003476079 6:6484393-6484415 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1003491747 6:6628285-6628307 AGGAAGAAGGGGAGGGAGGGAGG - Intronic
1003507630 6:6752547-6752569 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1003712138 6:8603836-8603858 AAGAAGGGAGGGAGGGAGGCAGG - Intergenic
1003759681 6:9162725-9162747 AAGAAAAAAGGAAGGAAGGCAGG + Intergenic
1003857108 6:10287580-10287602 AAGAAGAAAGGGAGGGAGAAAGG + Intergenic
1003866344 6:10366271-10366293 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1004015435 6:11727940-11727962 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1004131212 6:12921648-12921670 AAGAAGGAAGGGAGGGAGGAGGG + Intronic
1004206863 6:13599229-13599251 AAGAAGCAAGGGAGGGAGGAAGG - Intronic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004751325 6:18565584-18565606 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1004826990 6:19433582-19433604 AAGAATCACATTAGGGAGGCAGG - Intergenic
1004842852 6:19606633-19606655 AGGAATGAAGGGAGGGAGGGAGG + Intergenic
1005330731 6:24747610-24747632 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1005436251 6:25815242-25815264 AGGAATGAAGGGAGGGAGGGAGG + Intronic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1005665354 6:28047214-28047236 GTGAATAACTGGAGGGAGGCTGG - Intergenic
1005741852 6:28799251-28799273 AAGAAAGAAGAGAGGGAGGCAGG + Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1005790149 6:29291488-29291510 GAGAATAGCTAGAGGGAGGCTGG - Intergenic
1006384144 6:33719752-33719774 AAGAAGGAAGGGAGGGAGTCAGG + Intergenic
1006420098 6:33927865-33927887 AGGAAGAACTGGAAGGAGGCTGG + Intergenic
1006520123 6:34566426-34566448 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006744144 6:36329915-36329937 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1006745426 6:36338408-36338430 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1006932850 6:37697925-37697947 AGGAAGAGAGGGAGGGAGGCGGG - Exonic
1007104100 6:39271648-39271670 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1007118463 6:39361260-39361282 AAGAAGAATGGGTTGGAGGCTGG + Intronic
1007309506 6:40934382-40934404 AAGAAGAAAGGCAGGCAGGCTGG - Intergenic
1007623925 6:43231842-43231864 AGGAAGGACGGGAGGGAGGAAGG - Intergenic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1008505058 6:52222000-52222022 AAGGAAGACGGGAGGGAGGGAGG + Intergenic
1008537552 6:52518299-52518321 AAGAATGAAGGGACTGAGGCTGG + Intronic
1008672483 6:53785656-53785678 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1008913846 6:56764964-56764986 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1009292915 6:61906539-61906561 AAGAATAGTGGGAAGGAGGGGGG - Intronic
1009588582 6:65637793-65637815 AACAAGCACAGGAGGGAGGCTGG + Intronic
1009704946 6:67238604-67238626 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1009856720 6:69274484-69274506 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1010443678 6:75927726-75927748 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1010704400 6:79090134-79090156 AAGGAATAAGGGAGGGAGGCAGG - Intergenic
1010800481 6:80168725-80168747 AGGAAGAGGGGGAGGGAGGCAGG + Intronic
1011184361 6:84657933-84657955 AAGAATAACGCATGGAAGGCAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1011970024 6:93211340-93211362 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1012140567 6:95621984-95622006 AAGAAAGAAGGGAGGGAGGAAGG - Intergenic
1012515812 6:100057709-100057731 AAGAAGGAAGGGAGGAAGGCAGG - Intergenic
1012734320 6:102919725-102919747 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1013207626 6:107958637-107958659 TAGAATAGGGGGTGGGAGGCCGG + Intergenic
1013308326 6:108870613-108870635 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1013751397 6:113410801-113410823 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013954536 6:115825490-115825512 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1014028390 6:116674309-116674331 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1014315256 6:119856556-119856578 AAGAAGAAAGGAAGGGAGGGGGG - Intergenic
1014351575 6:120352802-120352824 AAGAAAAAAGGAAGGGAGGGAGG + Intergenic
1014730438 6:125025569-125025591 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1014963028 6:127710946-127710968 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1014971013 6:127815289-127815311 AAAAATGACGGAAGGGTGGCTGG - Intronic
1015053080 6:128865459-128865481 ATGAATTACGGGAGGAAGGTTGG - Intergenic
1015208409 6:130667838-130667860 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1016228992 6:141778671-141778693 AAGAATAACTGGAGGTATTCTGG - Intergenic
1016482509 6:144497137-144497159 AAGAGGAATTGGAGGGAGGCTGG + Intronic
1016981656 6:149860408-149860430 AAGAACAGCAGGAGGGAGGGAGG - Intronic
1017018690 6:150122693-150122715 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1017067966 6:150547717-150547739 AAGAGGAAAGGGAGGGAGGAGGG + Intergenic
1017189426 6:151636078-151636100 AAGGAAAAAGGGAGGGAGGGAGG - Intergenic
1017380254 6:153820426-153820448 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017567113 6:155699331-155699353 AAGAATAAAGGAAGGGTGGGAGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017755070 6:157522732-157522754 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1017923558 6:158891516-158891538 AAAAATAAAAGGATGGAGGCTGG - Intronic
1017931960 6:158963536-158963558 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1017988849 6:159469063-159469085 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1018132770 6:160748434-160748456 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1018403742 6:163454610-163454632 AAGAAGAAATGGAGGTAGGCAGG - Intronic
1018601029 6:165540977-165540999 AAGAATGAAGGGAGGAAGCCTGG + Intronic
1018733215 6:166668846-166668868 AAGAAAGGCGGGAGGGAGGGAGG - Intronic
1018936118 6:168275027-168275049 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1018957494 6:168419865-168419887 AAGAATGAGAGGTGGGAGGCGGG + Intergenic
1019313483 7:374059-374081 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1019623376 7:2003228-2003250 AGGAGAAACGGGAGAGAGGCGGG + Intronic
1019919999 7:4157383-4157405 AGGAATGAGGGGAGGGAGGGAGG + Intronic
1019954183 7:4399867-4399889 AAGACTGGCGGGAGGGAGGGGGG + Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020173830 7:5866446-5866468 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1020240418 7:6390083-6390105 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021646161 7:22791525-22791547 GAGAATAACTGCTGGGAGGCTGG + Intergenic
1021760700 7:23900780-23900802 ATAAATAAAGGGAGGGAGGGAGG - Intergenic
1021847144 7:24774300-24774322 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1021866121 7:24960118-24960140 AATAATATTGGGAGGGAAGCTGG - Intronic
1021971103 7:25966772-25966794 AAGAAGAAAGGGATGGAGGTAGG + Intergenic
1022110878 7:27230694-27230716 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1022363562 7:29685754-29685776 ACGAAGAATGGGAGGGAGGGAGG + Intergenic
1022541803 7:31144455-31144477 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1022644178 7:32215547-32215569 GAGACCAATGGGAGGGAGGCAGG + Intronic
1022667055 7:32421311-32421333 AACAATAACTGGAGTGAGGAAGG - Intergenic
1022918268 7:34983545-34983567 AAGAAGAGAGGGAGGGAGGGAGG + Intronic
1023320663 7:38994333-38994355 AAGAGGAATAGGAGGGAGGCGGG + Intronic
1023641341 7:42262252-42262274 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1024230664 7:47361036-47361058 AAGAATCTCAGGAGGGAGGGAGG - Intronic
1024283155 7:47736110-47736132 AAGAAAGAAGGGAGGGAGGGAGG - Intronic
1024294090 7:47829027-47829049 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1024515352 7:50248245-50248267 AAGAAAGGAGGGAGGGAGGCAGG + Intergenic
1024516390 7:50262602-50262624 AAGAAGAAGGGGAGGGAGATGGG - Intergenic
1024791142 7:52966102-52966124 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1024833363 7:53487637-53487659 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1025773433 7:64535409-64535431 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1025837934 7:65113116-65113138 AGGAATAAAAGGAGGGAGGGAGG + Intergenic
1025879335 7:65519964-65519986 AGGAATAAAAGGAGGGAGGGAGG - Intergenic
1025885134 7:65582865-65582887 AGGAATAAAAGGAGGGAGGGAGG - Intergenic
1026079394 7:67204479-67204501 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026162630 7:67883209-67883231 AAGAAAAACGGAAGGAAGGATGG - Intergenic
1026176010 7:67997729-67997751 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1026196992 7:68181674-68181696 AAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1026204307 7:68242453-68242475 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1026229205 7:68468720-68468742 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1026300144 7:69090599-69090621 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1026316042 7:69228528-69228550 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1026340551 7:69430498-69430520 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1026638788 7:72106626-72106648 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1026643594 7:72148955-72148977 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1026666577 7:72345550-72345572 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1026675346 7:72423944-72423966 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1026865048 7:73818509-73818531 AAGGAAAAAGGGAGGGAGGCAGG - Intronic
1026865539 7:73821913-73821935 AAGCATAAAGGGAGGGAGGGAGG + Intronic
1026870575 7:73848811-73848833 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1026953700 7:74363903-74363925 AAAAAAAAAGGGAGGGAGGAAGG + Intronic
1026997348 7:74626516-74626538 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1027654193 7:80908727-80908749 CAGAAAAATGGGAGGGAGACAGG + Intronic
1027688957 7:81317657-81317679 AGGAACAAAGGGAGGGAGGGAGG + Intergenic
1027733554 7:81905133-81905155 AAGAAAGAGGGGAGGGAGGGAGG - Intergenic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028403198 7:90446752-90446774 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1028742627 7:94293394-94293416 AAGAAGGAAGGGAGGGAGACAGG - Intergenic
1028924740 7:96345572-96345594 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1029084933 7:98004032-98004054 AAGAAGGAAGGGAGGGAGGGGGG - Intergenic
1029184460 7:98728709-98728731 AAGAAGAAGGGGAGGGAGAGGGG - Intergenic
1029253826 7:99255481-99255503 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1029634151 7:101772781-101772803 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029681577 7:102114928-102114950 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1029732184 7:102445818-102445840 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1030011321 7:105170774-105170796 AGGAAGGACGGGAGGGAGGGAGG + Intronic
1030329594 7:108257041-108257063 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1030497846 7:110321572-110321594 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1031014246 7:116555612-116555634 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1031081790 7:117265150-117265172 AAAAAAAAAGGGAGGGAGGCAGG - Intergenic
1031323815 7:120366492-120366514 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1031351642 7:120739221-120739243 GAGAATGAAGGGAGGGAGGGAGG + Intronic
1031419212 7:121529622-121529644 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1031448087 7:121879761-121879783 AAGAAAAAAGGAAGGGAGGAAGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032447159 7:131994184-131994206 AGGAATCACGGGAGGGAGGGAGG + Intergenic
1032685634 7:134231419-134231441 AAGAAGAAAGGAAGGGAGGAAGG - Intronic
1032813625 7:135448534-135448556 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1033096246 7:138433872-138433894 AAGAAGAAAGGGAGGAAGGGAGG + Intergenic
1033124234 7:138693686-138693708 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1033250176 7:139751962-139751984 AAGAAGAAAAGGAGGGAGGAAGG + Intronic
1033814692 7:145057564-145057586 ATGAAGAAAGGGAGGGAGACAGG - Intergenic
1033981312 7:147169645-147169667 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1034263302 7:149770329-149770351 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1034568627 7:151936152-151936174 AAAAATAAAAGGAGAGAGGCTGG - Intergenic
1034574021 7:151981653-151981675 AAGAAGAGGGGGAGGGAGGGAGG - Intronic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1035724442 8:1815886-1815908 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1035765258 8:2100212-2100234 AAGAAGAAAGGTAGGAAGGCAGG - Intronic
1035971951 8:4258512-4258534 AAGAATGAAGGGAGGGAGGGAGG + Intronic
1036385905 8:8281399-8281421 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1036561886 8:9905401-9905423 ATGAATAAGGGGGGGGATGCTGG + Intergenic
1037045695 8:14300288-14300310 AAGAATAAAGGGAGGGAAGGAGG + Intronic
1037259169 8:16987764-16987786 AAAAATAACTGGAGGCAGCCAGG - Intergenic
1037344460 8:17884084-17884106 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1037460999 8:19109590-19109612 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
1037540402 8:19865356-19865378 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1037747933 8:21661601-21661623 AGGAAAAAAGGGAGGGAGGGAGG + Intergenic
1037781057 8:21869337-21869359 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1037949449 8:23009187-23009209 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1038043461 8:23746371-23746393 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038170510 8:25127425-25127447 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1038340324 8:26680516-26680538 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1038392304 8:27213704-27213726 AGGAAGGAAGGGAGGGAGGCAGG + Intergenic
1038667661 8:29554250-29554272 AAAAAGAAGGGGAGGGAGGGAGG - Intergenic
1038914472 8:32005112-32005134 AAGAAAGAAGGGAGGGAGGATGG + Intronic
1039428449 8:37506249-37506271 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1039455907 8:37706399-37706421 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1039744120 8:40408349-40408371 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1039762404 8:40591564-40591586 AAGAATAAGGGAGGTGAGGCAGG - Intronic
1039779544 8:40770505-40770527 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1039907793 8:41798811-41798833 AAGCATCACGTGAGGAAGGCTGG - Intronic
1039977563 8:42380334-42380356 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1039977611 8:42380693-42380715 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1040030000 8:42815260-42815282 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1040931369 8:52738655-52738677 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1041675989 8:60540474-60540496 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1041866612 8:62581884-62581906 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1041866637 8:62581972-62581994 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1042006784 8:64189470-64189492 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042102012 8:65283962-65283984 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042397645 8:68310875-68310897 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1042809082 8:72804273-72804295 AAAAAAACCGGGAGGAAGGCAGG - Intronic
1043014178 8:74917906-74917928 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1043081923 8:75776826-75776848 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1043998420 8:86847667-86847689 AAGAGGAAAGGGAGGGAGGGAGG + Intergenic
1044118568 8:88365544-88365566 AGGAAGAGAGGGAGGGAGGCAGG + Intergenic
1044972751 8:97635731-97635753 AAGAAAAATGGCAGAGAGGCTGG - Intergenic
1045247181 8:100453302-100453324 AAGAATGAAAGGAGGGAGGGAGG + Intergenic
1045467404 8:102483254-102483276 AAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1045755135 8:105533780-105533802 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1046028686 8:108756738-108756760 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1046178517 8:110611167-110611189 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1046332277 8:112734256-112734278 AAGAAGAAAGGGAGAGAGGAAGG + Intronic
1046457707 8:114488994-114489016 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1046547890 8:115674472-115674494 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1046554732 8:115760812-115760834 AAGAAGAAAGGAAGGGAGGGAGG - Intronic
1046569749 8:115948219-115948241 AAGAAAAGAGGGAGGGAGGGAGG + Intergenic
1047023613 8:120804227-120804249 AGGAATAAAGGGAGGGAGAAAGG - Intronic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047648642 8:126896052-126896074 AAGAATGAGGGGAGAGATGCTGG - Intergenic
1047672056 8:127158734-127158756 AAAAAAAAAGGGAGGGTGGCAGG + Intergenic
1047736739 8:127772251-127772273 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1047767029 8:127998569-127998591 AAGAAAAGAGGGAGGGAGGAAGG - Intergenic
1047767750 8:128003214-128003236 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047857724 8:128930558-128930580 AAGAAGAAAAGAAGGGAGGCAGG - Intergenic
1047916042 8:129584780-129584802 AAAAAAAACGGGAGGCAGGGAGG - Intergenic
1048054999 8:130854892-130854914 AAGAAAAGGGGGAGGGAGGGAGG - Intronic
1048074454 8:131053918-131053940 AAGAAAAAAGGGAGAGAGGGAGG - Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1048912879 8:139152995-139153017 AAGACTAATGTGAGGGAGTCAGG - Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049226131 8:141451363-141451385 GAGGATATCGGGAGGGAGCCAGG + Intergenic
1049784890 8:144445660-144445682 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050339648 9:4622981-4623003 AAGAATAAGGGTAGCTAGGCCGG + Intronic
1050356575 9:4789113-4789135 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
1050366966 9:4881721-4881743 AAGAAAAAAGGGAGGGAGGAAGG - Intronic
1050601992 9:7262129-7262151 AAGAAGAGAGGGAGGGAGGGAGG - Intergenic
1050709854 9:8449250-8449272 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1050808856 9:9718807-9718829 AACAAGCACAGGAGGGAGGCTGG + Intronic
1051233655 9:14977564-14977586 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1051473418 9:17475533-17475555 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1051524158 9:18024019-18024041 AAGAAGAAAGGGAGGGAAGGGGG - Intergenic
1053277260 9:36792566-36792588 AGGAATGAAGGGAGGGAGGGAGG + Intergenic
1054851316 9:69849348-69849370 AAGAAGGAAGGGAGGGAGGAAGG + Intronic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1055354734 9:75426310-75426332 AAGAAGAAAGTGAGGGAGGAAGG - Intergenic
1055438062 9:76312105-76312127 AAGAATGGAGAGAGGGAGGCAGG + Intronic
1055595054 9:77857535-77857557 AAGAAGGAAGGGAGGGAGGGAGG + Intronic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1055708247 9:79031867-79031889 AAGAAGAAAGGGAGGCAGGAGGG + Intergenic
1055914530 9:81387333-81387355 AGGAATGCAGGGAGGGAGGCAGG + Intergenic
1056265514 9:84892978-84893000 AAAAAGGAAGGGAGGGAGGCAGG - Intronic
1056360687 9:85854728-85854750 AAAAAAAAAGGGAGGGAGGGAGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056614550 9:88152721-88152743 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1056697632 9:88873382-88873404 AAGAAGAAAGGGAGGGAGAGAGG + Intergenic
1057167375 9:92939882-92939904 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1058369261 9:104246034-104246056 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1058600945 9:106669569-106669591 AGGAATGAAAGGAGGGAGGCAGG + Intergenic
1058707607 9:107650182-107650204 AGGAAAAAAGGGAGGTAGGCTGG - Intergenic
1058960458 9:109988542-109988564 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1059643662 9:116242365-116242387 AAGAATAAATGAAGGGAGGAAGG + Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059675819 9:116538173-116538195 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
1059710172 9:116860587-116860609 AAGAATCATGGAAAGGAGGCTGG - Intronic
1059879496 9:118674460-118674482 AAGAAAAAAAGGAGGGAGGGAGG - Intergenic
1060123460 9:121018620-121018642 AAGAAAGAAGGGAGGGAGGGAGG + Intronic
1060603234 9:124891939-124891961 AAGAAGGGAGGGAGGGAGGCTGG - Intronic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061277605 9:129578473-129578495 AAGAAAGGCAGGAGGGAGGCGGG + Intergenic
1061278816 9:129585370-129585392 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1061432541 9:130540394-130540416 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1061675148 9:132211362-132211384 AAGACTGAAGGGAGGGAGGGAGG - Intronic
1061828772 9:133277397-133277419 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1062329840 9:136034380-136034402 AAGAAAAAAGGAAGGGAGGAAGG + Intronic
1062449080 9:136608079-136608101 AAGAATAAAGGAGGGGAGGAGGG + Intergenic
1062751251 9:138255268-138255290 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1203472800 Un_GL000220v1:123906-123928 AAGAAGAAAGGCAGGAAGGCAGG - Intergenic
1185524937 X:770325-770347 AAGATAAAAGGGAGGGAGGGAGG + Intergenic
1185562497 X:1070490-1070512 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185584241 X:1233309-1233331 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185598704 X:1324515-1324537 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1185611110 X:1394233-1394255 GAGAAAAACAGGAGGGAGGGAGG - Intergenic
1185623420 X:1466895-1466917 AGGAAGGACGGGAGGGAGGGAGG - Intronic
1185645537 X:1613075-1613097 AAGAAGGAAGGGAGGGAGGAAGG - Intergenic
1185700790 X:2228378-2228400 AGGAATGAAGGGAGGGAGGGAGG + Intronic
1185739286 X:2517938-2517960 AAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1185803235 X:3032370-3032392 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1185918126 X:4058855-4058877 AAGAATGAAGGGAGGGTGGGAGG + Intergenic
1186077609 X:5898009-5898031 AAGAAGGAAGGGAGGGAGGAAGG - Intronic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1186489418 X:9959766-9959788 AAGAATGGAGGGAGGGAGGAAGG - Intergenic
1187208778 X:17208507-17208529 AAGAAAGAAGGGAGGGAGGGAGG + Intergenic
1187231790 X:17430237-17430259 AAGAAAGAGGGGAGGGAGGGAGG - Intronic
1187693824 X:21898290-21898312 TAAAATAACCGGAGGCAGGCTGG + Intergenic
1187799340 X:23042948-23042970 AAGAATAACTGGATGGAGTGGGG + Intergenic
1188077362 X:25794622-25794644 AAGAAAAATGGAAGGGAGGGAGG - Intergenic
1188091942 X:25975361-25975383 AAAAAAAAAGGGAGGGAGTCTGG + Intergenic
1188737610 X:33738209-33738231 AAGGAGAAAAGGAGGGAGGCTGG + Intergenic
1189866165 X:45329447-45329469 AAGAAAAACGGAAGGGAGAGAGG + Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190372558 X:49756800-49756822 AAGAAAAACGGCAGGCAGGCAGG + Intergenic
1190953142 X:55165535-55165557 AAGAAGGAAGGGAGGGAGGGAGG - Intronic
1192831077 X:74751674-74751696 AAGAAAAGAGGGAGGGAGGGAGG - Intronic
1193027548 X:76861008-76861030 AAGAATACCTAGAGGGTGGCTGG + Intergenic
1194736913 X:97523230-97523252 AAAAATACTGGGAGGGAGGGAGG - Intronic
1195130021 X:101842324-101842346 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1195428955 X:104766426-104766448 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
1196259037 X:113555850-113555872 AAAAATACCGGAAGGCAGGCCGG - Intergenic
1196651667 X:118174140-118174162 AAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1196666437 X:118321913-118321935 AAGAAAAGAGGGAGGGAGGGAGG + Intergenic
1196690329 X:118552044-118552066 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197014735 X:121609764-121609786 AAGAATGAAGGGAGAGAGGGAGG + Intergenic
1197028767 X:121788371-121788393 AAGAAAGAAGGGAGGGAGGGAGG - Intergenic
1197175982 X:123486154-123486176 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1197267384 X:124389614-124389636 AGGAAGGAAGGGAGGGAGGCAGG - Intronic
1197568199 X:128114832-128114854 AAAAAGAAAAGGAGGGAGGCCGG - Intergenic
1197749068 X:129952673-129952695 AAGGAGAGCGGGAGGGAGGAGGG - Intergenic
1197924451 X:131632081-131632103 AAGAATAACGGTAAGCAGGGAGG + Intergenic
1198087388 X:133293932-133293954 AAGAGTAAGGGCAGGGAGGTGGG - Intergenic
1198789537 X:140328576-140328598 AAGAGTAATGAGAGGGCGGCCGG - Intergenic
1200082608 X:153585926-153585948 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1200116005 X:153770000-153770022 AAGGAGGACGGGAGGCAGGCGGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201256514 Y:12112927-12112949 AAGAAGGAAGGGAGGGAGGGTGG - Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic
1201318160 Y:12668602-12668624 AAGACTAACCTGAGGGGGGCTGG - Intergenic
1201736259 Y:17265245-17265267 AAGAATGGAGGGAGGGAGGGAGG + Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1202182454 Y:22151176-22151198 TAGAATAAAGGGAGGAAGGAAGG - Intergenic
1202208906 Y:22435226-22435248 TAGAATAAAGGGAGGAAGGAAGG + Intergenic
1202234150 Y:22690710-22690732 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1202309008 Y:23505456-23505478 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1202561792 Y:26165132-26165154 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic