ID: 1021299316

View in Genome Browser
Species Human (GRCh38)
Location 7:18952784-18952806
Sequence AACCTTGTACTGCCACAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021299315_1021299316 24 Left 1021299315 7:18952737-18952759 CCACATTTTAAAAAATGATTTTA 0: 1
1: 1
2: 40
3: 332
4: 2148
Right 1021299316 7:18952784-18952806 AACCTTGTACTGCCACAGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021299316 Original CRISPR AACCTTGTACTGCCACAGAG CGG Intronic
903490950 1:23728086-23728108 AGCCCAGTACCGCCACAGAGGGG + Intergenic
907020129 1:51059265-51059287 AACTTTGCTCTGCCCCAGAGTGG - Intergenic
908291707 1:62673876-62673898 AACCTTGTACTGGAAGAGGGAGG + Intronic
909129055 1:71712321-71712343 ATCCTTGTAGTCCCACAGGGAGG + Intronic
912628159 1:111223206-111223228 AACCCAGTTCTGCCACAGGGAGG - Intronic
919683991 1:200464536-200464558 AGCCTTGTACTGCCACAGCAGGG + Intergenic
923918038 1:238530532-238530554 AACTTTGGTCTGCCCCAGAGTGG + Intergenic
1066624563 10:37392947-37392969 AACCCTTTTCTGCCACACAGAGG + Intergenic
1068482758 10:57614737-57614759 AAACTTGTACATACACAGAGTGG + Intergenic
1069667397 10:70172053-70172075 AACCCTGTCCTGTCACAGAAAGG + Intergenic
1070148330 10:73790458-73790480 GACCTTGTACAGTCACAGAGTGG + Intronic
1072080445 10:92024662-92024684 AACCTTTTCTTGCCACAGAGAGG + Intronic
1072462438 10:95632007-95632029 AACATGGTACATCCACAGAGTGG + Intronic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1084334711 11:68449971-68449993 AGCCTTGGGCTGGCACAGAGAGG - Intergenic
1085816918 11:79747349-79747371 CACCTTGTAAGGCCCCAGAGAGG + Intergenic
1091461079 12:643602-643624 AGCGTTGTACGGCCACCGAGCGG + Intronic
1092981710 12:13801495-13801517 AAACTTGTACTGTCCCAGTGGGG + Intronic
1094175794 12:27539618-27539640 ACCCTTCTACTCCCACAGATAGG - Intronic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1102483377 12:113239435-113239457 AAACTTGTACTACCAGAAAGAGG - Intronic
1110198997 13:72826354-72826376 CACCTGGTATTTCCACAGAGAGG - Intronic
1111799030 13:92959890-92959912 CACCGTGCACAGCCACAGAGTGG - Intergenic
1112484721 13:99810130-99810152 AGCCTTGTGTTGCCACAAAGTGG - Intronic
1112956822 13:105070714-105070736 AACTTTGTACTTCAACATAGAGG + Intergenic
1120654259 14:87170108-87170130 AAACTGGTACTGCAGCAGAGTGG - Intergenic
1122087508 14:99317918-99317940 AACCCTGTATGGCCAGAGAGGGG - Intergenic
1128760764 15:70214779-70214801 AACCTGGTCCTGCCACAGGGTGG + Intergenic
1134278400 16:12796973-12796995 AACCTTATGCTACCACAAAGAGG + Intronic
1136450572 16:30352280-30352302 TGCATTGTACTGGCACAGAGAGG - Exonic
1139419895 16:66843912-66843934 AACCTTGTAGGGTAACAGAGAGG + Intronic
1141354947 16:83336437-83336459 AACATTTTAGTGCCCCAGAGAGG + Intronic
1141649650 16:85386076-85386098 AACCCTGACCTGTCACAGAGAGG - Intergenic
1144085302 17:11802937-11802959 ATCCTTGTTCTGCCACAAATTGG + Intronic
1144701824 17:17345361-17345383 AACCTTGAACTGCCGTAGAAAGG + Intronic
1147474184 17:40694359-40694381 AAGCTTGGACTTCCAGAGAGGGG - Intergenic
1148713153 17:49696569-49696591 AGGCTCATACTGCCACAGAGTGG + Intergenic
1149700784 17:58653786-58653808 AAACCTGGACTGCCACAAAGGGG - Intronic
1157983847 18:52414864-52414886 AATCTTGTACTGCAAGAGACAGG + Intronic
1159203188 18:65215542-65215564 TACCTTGTACCACCATAGAGAGG - Intergenic
1163529972 19:17843266-17843288 ACCCCTGGACTGCCACAGGGAGG + Intronic
925715008 2:6775810-6775832 AACCTTGTTCTGCCCCATAGGGG - Intergenic
926148611 2:10412000-10412022 AACCCTGTACTGCGACTCAGCGG - Intronic
926243470 2:11105124-11105146 AACCTCGTCCTGTCACAGCGTGG - Intergenic
927542504 2:23926247-23926269 GTCCTTGTCCTGCCCCAGAGGGG - Intronic
932024899 2:68122997-68123019 GACTTTGTACTGCCCCTGAGTGG + Intronic
935735613 2:106104551-106104573 AATCTTTTACTGCCACCTAGCGG - Intronic
939557389 2:143692314-143692336 AAGCTTGCACTGCCGCACAGTGG + Intronic
944206624 2:197164305-197164327 GACCTTGTGCTGCCAGAGAGGGG - Intronic
945137815 2:206647827-206647849 AACCTTGCTCTGCCACTGGGAGG + Intergenic
1172274846 20:33673913-33673935 AGCCTGGAGCTGCCACAGAGTGG + Intronic
1173983425 20:47242288-47242310 GCCCTTGTACTTCCCCAGAGAGG + Intronic
1177826578 21:26091107-26091129 AACCTTGCATTGCAACAGGGTGG + Intronic
1178143857 21:29716270-29716292 AAACTTGTACTGGCACAGTGGGG + Intronic
1178494824 21:33077860-33077882 AACCATGAACTGCCCCAGCGAGG + Intergenic
1184743798 22:46444399-46444421 AAGCTTGTCCTGCCCCCGAGGGG + Intronic
950476357 3:13217457-13217479 AACTTGGTACTTCCACACAGTGG - Intergenic
952415098 3:33082880-33082902 AACCTAGAAAAGCCACAGAGAGG + Intronic
954332437 3:49898171-49898193 AGCCTTGTACTGCCCCTTAGAGG + Exonic
959578960 3:107964724-107964746 AACATTCTTCTGCCAGAGAGGGG + Intergenic
961058101 3:123805732-123805754 ACCCTGCTACTGCCACACAGTGG + Intronic
963481767 3:145884637-145884659 AACCTTGTGCTAGCACATAGTGG + Intergenic
966436934 3:179897355-179897377 AAACTGGTAGTTCCACAGAGTGG + Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978246896 4:106583702-106583724 GACCTTGGAGTTCCACAGAGAGG - Intergenic
984656456 4:182323928-182323950 AACCTTGTATCTTCACAGAGAGG + Exonic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986441802 5:7789582-7789604 CATCTTGTCCTGCCAGAGAGTGG - Intronic
988683204 5:33503180-33503202 ACCCTCCTCCTGCCACAGAGAGG + Intergenic
991206316 5:64053961-64053983 ATCTTTGCACTGCCACAGAGTGG - Intergenic
993327528 5:86560503-86560525 ATCCTTGTCTTGCCAAAGAGGGG - Intergenic
999542989 5:152594701-152594723 AAAGTTGTAATGGCACAGAGTGG - Intergenic
1001265106 5:170268478-170268500 AACCTTGTGTTTCCACAGACCGG - Exonic
1003778151 6:9392434-9392456 AATCTTGCACTGCCATAGACAGG - Intergenic
1004325307 6:14669164-14669186 ACCCTTTTACTGGCACAGAGTGG - Intergenic
1004603912 6:17176228-17176250 AACCCCGTTCTGCCACAGAGAGG + Intergenic
1005195563 6:23279562-23279584 AACCTTGGACAGAAACAGAGTGG - Intergenic
1007733335 6:43965148-43965170 CACCAGGTACTGCCACAGAGAGG - Intergenic
1007936895 6:45740615-45740637 ATCCTTGCAGTGCCACAGAACGG - Intergenic
1014384647 6:120785816-120785838 AACTTTGCTCTGCCCCAGAGTGG - Intergenic
1014570853 6:123005759-123005781 AGCCTTGTCCTGCCACACTGTGG - Intronic
1018418376 6:163620926-163620948 ACTCTCGTGCTGCCACAGAGTGG - Intergenic
1019832937 7:3351149-3351171 AGCCTTGTACTTCCATAGATTGG + Intronic
1019900977 7:4020441-4020463 AGCAATGTACTGTCACAGAGGGG - Intronic
1021299316 7:18952784-18952806 AACCTTGTACTGCCACAGAGCGG + Intronic
1022774564 7:33512680-33512702 AACAATGTACTGTCACAGAAAGG - Intronic
1028109132 7:86917646-86917668 GATCTTTTACTGCCACAAAGTGG + Intronic
1030233776 7:107236215-107236237 AACCTTGAAATACCAAAGAGAGG + Intronic
1036409026 8:8481160-8481182 AACCTTGTTCAGCCACAGCTGGG + Intergenic
1039818124 8:41112687-41112709 CACCTTGTACTGCCTCAGCTGGG + Intergenic
1040721394 8:50329132-50329154 AACCCTGCAGTGCCACAGGGTGG - Intronic
1050888072 9:10790480-10790502 AACCTTGTTCTGCCCTGGAGTGG - Intergenic
1053056494 9:34996137-34996159 AACCTTTAAATCCCACAGAGAGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1058748715 9:108017743-108017765 AGCTTTGTAGTGCCACAGTGAGG - Intergenic
1060618553 9:125042486-125042508 AACAGTGTAATGCCATAGAGAGG - Intronic
1191783986 X:64897656-64897678 CACTTGGTACTGCCCCAGAGGGG + Intergenic
1199004464 X:142678764-142678786 AACTTTGTACTTCTACAGGGTGG - Intergenic
1201509744 Y:14745995-14746017 ATCCTTGGACAGCCACAGACAGG + Intronic