ID: 1021299835

View in Genome Browser
Species Human (GRCh38)
Location 7:18958910-18958932
Sequence CCATTTCCACGGGTAAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021299835 Original CRISPR CCATTTCCACGGGTAAGCTT GGG Intronic
903264843 1:22151706-22151728 CCATTGCCCTGGGGAAGCTTGGG + Intergenic
903867859 1:26411630-26411652 CCATATCCACGGGTGGGCTCCGG + Intronic
910033941 1:82767327-82767349 CCATTTCCCTGGCCAAGCTTTGG - Intergenic
915253097 1:154604452-154604474 CCAGTACCACTGGGAAGCTTTGG - Intronic
1073255580 10:102148927-102148949 CCGTGTCCAAGGGTAAGCTTGGG + Exonic
1078329503 11:10408090-10408112 GCACTTCCACGGGGAAGCTCTGG + Intronic
1079217363 11:18525955-18525977 CCAGTTCAACGTGTTAGCTTGGG - Intronic
1081834685 11:46143855-46143877 CCACTTCCAGGGGAAAGCTGGGG + Intergenic
1083184397 11:61008762-61008784 GCAGTCCCACAGGTAAGCTTCGG - Exonic
1083479870 11:62936915-62936937 CCATGTCCACCAGTAGGCTTAGG + Intronic
1085327123 11:75614732-75614754 CCATTTACATGGCTAAGTTTTGG + Intronic
1086718110 11:90087521-90087543 ACATTTCCACAGGGAAGTTTGGG - Intergenic
1096823518 12:54256158-54256180 CCATTTCCACTGGAAATATTTGG - Intronic
1096854011 12:54465622-54465644 CCATTTCCACAGGCAAGTTGGGG + Intronic
1097318854 12:58203394-58203416 CCAGTTACAGGGCTAAGCTTTGG - Intergenic
1099783650 12:87233154-87233176 TCATTTCCATGGGTTAGCTCTGG + Intergenic
1099918957 12:88933218-88933240 TCATTTCCAAGGGCAAGCTAGGG - Intergenic
1101563714 12:105884706-105884728 CCATATCAACATGTAAGCTTGGG - Intergenic
1102611550 12:114116718-114116740 CCATTTCCATGGATGAGCCTGGG - Intergenic
1103162165 12:118738508-118738530 CCATTTTCACGGGTCACCTCAGG + Intergenic
1103746238 12:123126290-123126312 GCATATCCTTGGGTAAGCTTGGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1116562941 14:46405043-46405065 ACATTTCCAAGGGTCAGATTTGG - Intergenic
1124685577 15:31779065-31779087 CCATTTCCACAGCAGAGCTTGGG + Intronic
1126704128 15:51391866-51391888 CCACTACCAGTGGTAAGCTTGGG - Intronic
1129142204 15:73609705-73609727 GCATTTCCAAAGGTAATCTTTGG - Intronic
1136400157 16:30012484-30012506 CCATTTTTAAGGGTAAGATTAGG - Intronic
1151419796 17:73989771-73989793 TCATGTCCACGTGTAAGCATGGG + Intergenic
1152476308 17:80520678-80520700 CCATTTCCATGGCTAAGTTACGG - Intergenic
1160421905 18:78753727-78753749 CCTTTTCAACGGCAAAGCTTTGG - Intergenic
1162431625 19:10632206-10632228 CCATTTCCACGGGAAAGGGCAGG - Intronic
1162827557 19:13262989-13263011 CCATTTCACCTGTTAAGCTTGGG + Intronic
925841320 2:7994918-7994940 CAGTTTCCACAGGTAACCTTTGG + Intergenic
929415462 2:41742811-41742833 CTATTTCCACAGCAAAGCTTTGG + Intergenic
933249168 2:80009138-80009160 CCATATACTCAGGTAAGCTTTGG - Intronic
938870250 2:135467867-135467889 CCATTTATACTGGTAAGCTTAGG + Intronic
940626256 2:156178931-156178953 CCATCTCCACTGCTAAACTTTGG - Intergenic
1174066988 20:47872783-47872805 GCATTCCCATGGATAAGCTTGGG + Intergenic
1184622356 22:45690936-45690958 CCACTGTGACGGGTAAGCTTGGG + Intronic
954095722 3:48326150-48326172 CCATTGCCCCCTGTAAGCTTAGG + Intronic
960490627 3:118313329-118313351 CCATTGCCAGGGGTAGGGTTGGG - Intergenic
976610279 4:87023934-87023956 GCATTTCCACTGGTAAACCTGGG + Intronic
978049958 4:104186232-104186254 CAAATTCCACTGGAAAGCTTGGG - Intergenic
978715370 4:111836375-111836397 CCATTTCAAATGGTAAGTTTAGG - Intergenic
981260586 4:142713858-142713880 CCCTTTCCCTGGGTAAACTTTGG + Intronic
986445808 5:7820190-7820212 CCATTGCAAAGGGGAAGCTTTGG + Intronic
993629055 5:90261559-90261581 CCATTTCCAAGGCTAATGTTTGG - Intergenic
997279052 5:132626788-132626810 CCATTTACCTGGGTAATCTTGGG - Intronic
1005300330 6:24464386-24464408 CCAGGTCCACGGGAGAGCTTGGG + Intronic
1013846478 6:114459061-114459083 CCATTTCAACAGGTAAGTTTTGG - Intergenic
1019375787 7:691262-691284 CCATTTCCACTGGCGAGTTTGGG - Intronic
1021299835 7:18958910-18958932 CCATTTCCACGGGTAAGCTTGGG + Intronic
1033281026 7:140006436-140006458 CCATTTGCACAGGTCAGATTAGG - Intronic
1035534611 8:381659-381681 CCTTCTCCACGGGGAAGGTTCGG - Intergenic
1041002417 8:53465599-53465621 CCATTGTCACCTGTAAGCTTTGG - Intergenic
1045043754 8:98254200-98254222 CCATTTCCCAGGGTAGGTTTGGG + Intronic
1047437652 8:124848004-124848026 CCATTTCTTCTGGTAAGGTTTGG - Intergenic
1047777295 8:128083573-128083595 CCATTTGCATGGGCAAGTTTGGG - Intergenic
1059345217 9:113623719-113623741 CCATTTCCAGGAGTAACCCTGGG + Intergenic
1060678253 9:125536852-125536874 CCTTTTCCACAGGGCAGCTTAGG + Intronic
1190310263 X:49112318-49112340 CCATTTTCAAGCGTAGGCTTAGG + Intergenic
1190487220 X:50939737-50939759 ACATTTCCAAAGGTAAGTTTTGG + Intergenic
1195928462 X:110049758-110049780 GCTTTTCCATGTGTAAGCTTGGG + Intronic
1198218072 X:134574867-134574889 CCATTTGCCTGGGTAAACTTGGG - Intronic