ID: 1021308796

View in Genome Browser
Species Human (GRCh38)
Location 7:19065654-19065676
Sequence CTGGAGCAGCAGTGGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021308792_1021308796 9 Left 1021308792 7:19065622-19065644 CCACTTGTATAAACAATAATATT 0: 1
1: 0
2: 2
3: 23
4: 489
Right 1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021308796 Original CRISPR CTGGAGCAGCAGTGGCTCAA AGG Intronic
No off target data available for this crispr