ID: 1021309694

View in Genome Browser
Species Human (GRCh38)
Location 7:19078588-19078610
Sequence CTGTGGGTGTGTAGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1167
Summary {0: 1, 1: 0, 2: 6, 3: 120, 4: 1040}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021309694 Original CRISPR CTGTGGGTGTGTAGGGAGAG GGG Intronic
900327137 1:2113908-2113930 GTGTGGGAGTGTAGAGAGGGCGG + Intronic
900855189 1:5175911-5175933 ATGTGTGTGTGTTGGGAGTGGGG - Intergenic
900988179 1:6085485-6085507 CTGTGGATGAGTTGGGACAGAGG - Intronic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902098205 1:13963793-13963815 GTGTGTGTGTGTAGGGGTAGTGG + Intergenic
902394512 1:16125321-16125343 CTGTGGGCCGGGAGGGAGAGAGG + Intronic
902477486 1:16695993-16696015 CTGGGGGTGTGTGTGGAGACTGG + Intergenic
902547650 1:17199917-17199939 GTGTTGGTGGGTAAGGAGAGGGG - Intergenic
902836789 1:19052751-19052773 GTGTGTGTGTGTATGGAGAAGGG - Intergenic
903172143 1:21560927-21560949 ATCTGGGGGTGAAGGGAGAGAGG + Intronic
903187933 1:21639856-21639878 CTGTGGGTGAGAATGGAGATGGG + Intronic
904055459 1:27667060-27667082 GTGGGGGTGGGTGGGGAGAGAGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904521736 1:31101184-31101206 CTGTGCGTGTGCTGGGAGAAAGG - Intergenic
904594520 1:31635127-31635149 CTGTGGGTGTGCAGGCAGCCTGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904941161 1:34165575-34165597 GTGTGTGTGTGTGTGGAGAGGGG - Intronic
905166534 1:36086421-36086443 CTGCGGGTGTGTAGGACGCGTGG + Intronic
905166543 1:36086471-36086493 CTGCGGGTGTGTAGGGCACGTGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905585491 1:39114112-39114134 GTGGGGGTGTGTAGGGGCAGGGG - Intronic
905740904 1:40370700-40370722 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906657617 1:47560082-47560104 CTGTGAGTGGGTGGGGAGTGAGG + Intergenic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907289063 1:53401277-53401299 CTGTGAGGGTGTAGGGGCAGTGG + Intergenic
907710463 1:56876005-56876027 GTGTGAGTCTGGAGGGAGAGGGG + Intronic
907756272 1:57313751-57313773 CTGTGTGTTTGCAGGAAGAGGGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908381921 1:63604949-63604971 GTGTGTGTGTGTAAAGAGAGGGG + Intronic
908674765 1:66591512-66591534 CTGTGCATGTGTAGGGGCAGGGG - Intronic
908802231 1:67892127-67892149 CTGTGTGTGTGCAGGGTCAGGGG - Intergenic
909811625 1:79938534-79938556 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
910109486 1:83667450-83667472 GTGTGTCTGTGTAGGGAGACAGG - Intergenic
910335581 1:86126421-86126443 TGGTGTGTGTGTAGGGGGAGGGG - Intronic
910825531 1:91404185-91404207 CTGTTGGTGCCTGGGGAGAGGGG - Intronic
911646253 1:100340138-100340160 CTGTTGTTGGGTGGGGAGAGAGG + Intergenic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
912149304 1:106837576-106837598 CTATGTATGTGTAGGGACAGAGG + Intergenic
912439578 1:109688037-109688059 CTGTGTGTGTGTTGGGGGTGTGG + Intronic
912799963 1:112714491-112714513 TTCTGGGTGTGGAGGGGGAGGGG + Intronic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913152431 1:116057901-116057923 CTGTTGTTGGGTGGGGAGAGGGG + Intronic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
913596371 1:120381931-120381953 CTGTCGTTGGGTAGGGGGAGGGG + Intergenic
914090899 1:144497044-144497066 CTGTCGTTGGGTAGGGGGAGGGG - Intergenic
914307704 1:146437163-146437185 CTGTCGTTGGGTAGGGGGAGGGG + Intergenic
914594405 1:149135973-149135995 CTGTCGTTGGGTAGGGGGAGGGG - Intergenic
914746646 1:150506200-150506222 CTGGGTGCTTGTAGGGAGAGTGG - Intronic
914756215 1:150562842-150562864 CTGAGGGTGTGCTGGGGGAGGGG + Intergenic
915250542 1:154585204-154585226 CTGTGGATGGGTAAGGAGACAGG - Exonic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915757535 1:158277298-158277320 CTGTTGGGGGGTAGGGGGAGGGG - Intergenic
915769682 1:158407292-158407314 CTGTGTGTGTGTCGGGGGACGGG + Intergenic
915900854 1:159845763-159845785 CAGTGGATGTGGTGGGAGAGTGG + Intronic
915933374 1:160074669-160074691 CTTTGGGTGTATAGGGGCAGTGG - Intergenic
915997329 1:160576491-160576513 CTGTGGGTGGGTATAGAGAAAGG + Intronic
916065361 1:161132162-161132184 CTGAGGGTGTGAAGGGGAAGGGG - Intronic
916559224 1:165918555-165918577 CTGTGGGTGTGTATGGTGAGTGG + Intergenic
916990822 1:170242920-170242942 CTGTGTGTGTGTGTGGGGAGGGG + Intergenic
916990824 1:170242922-170242944 GTGTGTGTGTGTGGGGAGGGGGG + Intergenic
917460337 1:175223736-175223758 GTGTGTGTGTGTACAGAGAGAGG + Intergenic
917724916 1:177819135-177819157 CCCTAGGTGGGTAGGGAGAGGGG + Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917801408 1:178573844-178573866 CTGTGGGTGTATGGGGAGCAGGG - Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918212436 1:182362999-182363021 CTGGGGGTGTGTTGGGAGGTGGG - Intergenic
919193768 1:194257120-194257142 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
919465661 1:197919867-197919889 CCCAGGGTGTGCAGGGAGAGCGG - Intronic
919563667 1:199156988-199157010 CTGTGCACATGTAGGGAGAGGGG + Intergenic
919766128 1:201128297-201128319 GTGTGAGTGTGTAGGGAGCAGGG - Intergenic
919841703 1:201614054-201614076 CTGGGGGCGAGTGGGGAGAGGGG + Intergenic
919858965 1:201725710-201725732 CTTTGGGAGTCCAGGGAGAGAGG + Intronic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920293248 1:204939076-204939098 GTGTGTGTGTGTAGGGGGATTGG + Intronic
921327479 1:214000752-214000774 CTGTTGGTTTGTAGAGAGATTGG + Intronic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922987281 1:229875511-229875533 GTGTGTGTGTGTAGGGGGAAGGG - Intergenic
923031467 1:230252236-230252258 CTGTGGGTGTGCATTGGGAGAGG + Intronic
923274217 1:232382926-232382948 CAGTGGGTGTGTGAGGAGGGAGG + Intergenic
923372257 1:233326871-233326893 CTGTGGGTTTCCAGGGAGACTGG + Intergenic
923945569 1:238883288-238883310 ATGTGTGTGTGTAGAAAGAGTGG + Intergenic
924332476 1:242953891-242953913 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
924417813 1:243877051-243877073 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
1062932182 10:1360640-1360662 CTGTGGGTGTGCATGGGGAGCGG + Intronic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063877515 10:10495548-10495570 CTGTGGCTGTTCAGGTAGAGAGG - Intergenic
1064038894 10:11940612-11940634 ATATGGGTGTGTAGGGGGTGAGG - Intronic
1064220943 10:13439949-13439971 CTGTGGGTGTTTAGGGCGACTGG - Intronic
1064904409 10:20330410-20330432 CTCTGGGTCTGTAATGAGAGAGG - Intergenic
1065276201 10:24088442-24088464 CTGTTGTTGAGTAGGGGGAGGGG - Intronic
1065768830 10:29057540-29057562 GTGTGTGTGTGTATGGAGTGGGG - Intergenic
1065908171 10:30278116-30278138 CTGTCGGTGGGTAGGGAGAAAGG + Intergenic
1066819954 10:39472675-39472697 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1067146646 10:43699057-43699079 AACTGGGTGTGGAGGGAGAGGGG + Intergenic
1067414493 10:46093146-46093168 CTGGGTGTGTGTTGGGGGAGTGG - Intergenic
1067434555 10:46267688-46267710 CTGGGTGTGTGTTGGGGGAGTGG - Intergenic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1067684359 10:48457920-48457942 TTGGGGGTGGGTAGGGAGGGGGG + Intronic
1067747481 10:48946981-48947003 GTGTGTGTGTGTACAGAGAGTGG - Intronic
1067955953 10:50790808-50790830 TTGTGGTTGTTTGGGGAGAGGGG - Intronic
1068339444 10:55683220-55683242 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
1069244637 10:66188566-66188588 CTGTGTGTGTGTGGGGGGAGGGG + Intronic
1069547431 10:69338777-69338799 GTGTGTGTGTGTAGAGAGAGAGG + Intronic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1070411198 10:76142838-76142860 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1070764911 10:79050859-79050881 CTGGGGGTGGGTGGGGAGAAGGG - Intergenic
1071234642 10:83631246-83631268 GTGTGTGTGTGTAGGGTGGGAGG + Intergenic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071518315 10:86313778-86313800 CTGGGGATGTGTGGGAAGAGTGG - Intronic
1072111672 10:92327038-92327060 CTGTGTAAGTGTAGGGAGAGAGG - Intronic
1072931669 10:99669677-99669699 CTGTGCATGTGTAGGGTCAGGGG - Intronic
1073131690 10:101193154-101193176 GTGTGTGTGTGTTGGGGGAGAGG + Intergenic
1073316969 10:102589095-102589117 GTGTGTGTGTGTATGGAGATGGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073577985 10:104641208-104641230 GCGTGTGTGTGTAGGGGGAGTGG - Exonic
1073752284 10:106542401-106542423 GTGTGTGTGTGTAGGGATATAGG - Intergenic
1073892750 10:108119837-108119859 CTGTGGTTGGGTGGGGGGAGGGG + Intergenic
1074152712 10:110771759-110771781 AGGAGGTTGTGTAGGGAGAGGGG + Intronic
1074180852 10:111061490-111061512 CTGTGGGTGTGTCTGCTGAGGGG + Intergenic
1074266466 10:111909357-111909379 GTGTGTGTGTGTAGAGAGAGAGG + Intergenic
1074305954 10:112278709-112278731 GTGGGGGTGAGGAGGGAGAGGGG + Intergenic
1074612428 10:115035022-115035044 GTGTGTGTGTCTAGAGAGAGAGG - Intergenic
1074854233 10:117461707-117461729 CTGAGCCTGTGTAGGAAGAGGGG - Intergenic
1075153487 10:119955656-119955678 TTCTGGCTGTGTGGGGAGAGAGG + Intergenic
1075678358 10:124313550-124313572 GTGTGTGTGTGTAGGAGGAGAGG - Intergenic
1075722543 10:124595880-124595902 GGGTGGCTGTGCAGGGAGAGCGG - Intronic
1075945352 10:126428258-126428280 CTGTGGGTGTCTGGGGAGCTGGG + Intronic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076122614 10:127948311-127948333 CTGTGTGTGTGTAGGGTTAAGGG - Intronic
1076413080 10:130265583-130265605 CTGTGGGAGGGTAGTGAGAAGGG + Intergenic
1076435148 10:130435648-130435670 CTGTGGATGTTTAGGGGTAGGGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1077037862 11:503955-503977 CTTTGGCTGTGTAGGGAGCCAGG - Intronic
1077223388 11:1427126-1427148 CAGTGGGGCTGTGGGGAGAGAGG - Intronic
1077354347 11:2108268-2108290 CAGAGGGAGTGAAGGGAGAGAGG + Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077414386 11:2418019-2418041 CTGTGGGCCTGAAGCGAGAGTGG + Intronic
1077648105 11:3944447-3944469 CTGTGCCTGTGTAGTGGGAGTGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078350126 11:10586154-10586176 CTGTGTGTGTGTGTGGAGGGTGG + Intronic
1078354658 11:10624834-10624856 CTGCAGGAGTGTAGGGAGTGAGG + Intronic
1078497786 11:11837617-11837639 GGGTGTGTGTGTAGGGACAGTGG + Intergenic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1078614967 11:12856395-12856417 CTGTGAATGTTTAGGGAAAGGGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078932463 11:15922756-15922778 ATGTGGGTGGGTAGGGACTGGGG + Intergenic
1079496744 11:21052838-21052860 CTGTGGGTGAGTCGAGGGAGTGG + Intronic
1079740234 11:24049692-24049714 TTGTGAGTGTGTAGGTAGAGGGG + Intergenic
1079868530 11:25765451-25765473 TTGTGTGTGTGTGGGGAGAGGGG + Intergenic
1079943331 11:26710013-26710035 CTGTGGGTGGGTAGGGGGCTAGG - Intronic
1079951346 11:26808867-26808889 GTGTGTGTGTGTAGGAAGAGGGG + Intergenic
1080157736 11:29131960-29131982 GTGTGTGTGTCTAGGGAGTGTGG - Intergenic
1080167059 11:29251239-29251261 CTGTGCATGTGTAGGGACAGGGG + Intergenic
1080268736 11:30427765-30427787 CTCTGGGGGTGAAGGGAGAGGGG + Intronic
1080791366 11:35525386-35525408 CTGTGTGTGTTTGGGGTGAGGGG - Intronic
1081602386 11:44504202-44504224 GTGTGTGTGTGTAGGAAGAAAGG - Intergenic
1081929767 11:46860896-46860918 CTGTGTGTTTGTAGAGGGAGTGG - Intronic
1082079289 11:47999752-47999774 CTATGGGTATGTAGGGCTAGTGG + Intronic
1082909183 11:58350930-58350952 CTGTGGGTGAGTAGGAAGCCTGG + Intergenic
1083268041 11:61556030-61556052 GTGTGTGTGTGTGGGGAGGGGGG + Intronic
1083275079 11:61592353-61592375 GTGTGTGTGTGTAGGGAGTGGGG + Intergenic
1083443682 11:62692975-62692997 GTGTGGTTGAGTAGGGAGAGAGG - Intronic
1083676968 11:64331716-64331738 ATGTGTGTGTGTAGGGAGTTGGG + Intergenic
1083777088 11:64899376-64899398 CAGCGGGTGTGCAGGAAGAGGGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083932942 11:65855830-65855852 GTGTGGGTTTGGAGGGGGAGGGG - Intronic
1084035126 11:66504963-66504985 CTGTGTGTGTGTCGGGGGGGTGG - Intronic
1084539962 11:69780039-69780061 CTGTGAGTGTGTGGGGACAGAGG - Intergenic
1084579546 11:70014561-70014583 CTGTGGGTGTTTGGGGTGACTGG + Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085041668 11:73330564-73330586 CTGTGGCTGTGGAGGGGCAGGGG + Intronic
1085277758 11:75310907-75310929 CTGTGGTTGTGGTGGGACAGAGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1085474750 11:76782946-76782968 CTGTGTGTGTGGAAAGAGAGAGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085655420 11:78310151-78310173 ATGTGGGGGTGGAGGGAGTGAGG + Intronic
1086485248 11:87293507-87293529 CTGTTGGGGTGTGGGGAGTGAGG - Intronic
1087055574 11:93932641-93932663 CTGTGTGTGTATAGGGGCAGGGG + Intergenic
1087146140 11:94813566-94813588 CAGTGGGTGTGTAGCGAGAGAGG - Intronic
1087242645 11:95797161-95797183 GTGTGTGTGTGTTGGGAGGGGGG - Intronic
1087705743 11:101489981-101490003 CTGTTGGTGTGTATGGAAACTGG + Intronic
1088537948 11:110882064-110882086 CTGTTGTGGGGTAGGGAGAGGGG + Intergenic
1088660146 11:112037210-112037232 CTGTGAGTTTGGAGGGATAGTGG + Intronic
1089014617 11:115155909-115155931 CTGCAGGTGAGTAAGGAGAGAGG + Intergenic
1089077982 11:115753947-115753969 CTGTGGGTCAATAGGGAAAGAGG + Intergenic
1089879979 11:121764090-121764112 GTGTGGGTGACTAGAGAGAGAGG + Intergenic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1090739912 11:129649783-129649805 CTGTGTATGTGTGGGGACAGTGG + Intergenic
1090847245 11:130540592-130540614 CTGTGCATGTGTGGGGACAGGGG - Intergenic
1090868192 11:130720598-130720620 ATGAGGGTCTGTGGGGAGAGGGG + Intergenic
1091123940 11:133080093-133080115 TTGTGGATGGGTAGGGTGAGTGG - Intronic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092132889 12:6124826-6124848 GTGTGGGGGTGTAGGGATAGGGG - Intergenic
1092205754 12:6613493-6613515 GTCTGTGTGTGTAGGGAGATGGG + Intergenic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1092773477 12:11919786-11919808 CTGTGCGTGTGTGGGGTCAGGGG - Intergenic
1092870125 12:12798824-12798846 CTGTGGGTGTGTATTGGGAAGGG - Intronic
1093112667 12:15170332-15170354 CTGGGTGTGTGTAGGGGGAAGGG + Intronic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1093487549 12:19667698-19667720 GTGTGTGTGTGTAGAGAGAGTGG + Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095737944 12:45578004-45578026 ATGTGGGTGTGTATGTGGAGAGG + Intergenic
1095779488 12:46043770-46043792 CTGTGTGTGTGTTGCGAGGGTGG + Intergenic
1096039975 12:48506755-48506777 CTGTGCATGTTTAGGGACAGAGG + Intergenic
1096216936 12:49803072-49803094 CTGTGGGTCTGTAGTGGGACTGG - Intronic
1096255188 12:50058166-50058188 CTGTGTGTATGTTGGGAGTGGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096716411 12:53494037-53494059 GTGTGTGTGTGTTGGGAGAGAGG - Intronic
1096730151 12:53603569-53603591 TTGTGGGTGTTTAAGAAGAGAGG - Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096778714 12:53979646-53979668 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
1096806910 12:54146567-54146589 CAGTGGGGGTGGGGGGAGAGTGG - Intergenic
1096902167 12:54895524-54895546 CTGTGCATGTGTGGGGACAGAGG + Intergenic
1097083808 12:56453053-56453075 CTGGGTGAGTGAAGGGAGAGGGG - Exonic
1097090824 12:56503345-56503367 GTGTGTGTGTGTGTGGAGAGGGG + Intergenic
1097260631 12:57718125-57718147 CCCTGGGTGGGTAGGGAGTGGGG - Exonic
1097322362 12:58240398-58240420 GTGTGTGTGTGTGGGGATAGGGG + Intergenic
1097669554 12:62519311-62519333 CTGGGGGTGGGTGGTGAGAGGGG + Intronic
1097931648 12:65193764-65193786 GTGTGTGTGTGTTGGGGGAGGGG + Intronic
1098147710 12:67515010-67515032 GTGTGTGTGTGAAGAGAGAGGGG - Intergenic
1098593700 12:72245259-72245281 GTGTGTGTGTGTAGAGGGAGAGG + Intronic
1099016575 12:77350425-77350447 CTGTGTGTGTGTTGAGAGAAAGG + Intergenic
1099444264 12:82733475-82733497 TTGTGCATGTGTAGGGAGGGTGG + Intronic
1099499934 12:83401837-83401859 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100465608 12:94842121-94842143 GTGTGTGTGTGTAGGGGGACTGG - Intergenic
1100581730 12:95945684-95945706 GTGAGTGTGTATAGGGAGAGGGG + Intronic
1100670151 12:96802825-96802847 CTGTCGGTGGGTAGGGAGCAGGG - Intronic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101355811 12:103976399-103976421 GTGTGTGTGTGTGGGGAGACAGG - Intronic
1101714645 12:107300219-107300241 CTGTCGTGGGGTAGGGAGAGGGG - Intergenic
1102129135 12:110511578-110511600 GTGTGGGTGAGTATGAAGAGAGG + Intronic
1102547116 12:113665206-113665228 CTGTGTGTGTATAGGGGGTGAGG - Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102563328 12:113778429-113778451 CTCTGTGTGTGGTGGGAGAGGGG + Intergenic
1103240004 12:119405141-119405163 CTGGGGGTGTGCACGGAGACAGG - Intronic
1104209584 12:126675726-126675748 GTGTGTGTGTGTAGAGAGAGAGG - Intergenic
1104463735 12:128974100-128974122 CTGTGCGTGTGGAGGGGGAGAGG + Intronic
1104503001 12:129303816-129303838 CTGTGGGTGGGTGGGTTGAGGGG + Intronic
1104588938 12:130068968-130068990 CTGAGGCTGTGTGGGGAGGGAGG + Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104965240 12:132505976-132505998 CTGGGGGTGTGTGGGCACAGGGG + Intronic
1105880109 13:24598031-24598053 CTGTGTGTGTGTTGGGAGTTGGG - Intergenic
1106051637 13:26195779-26195801 GTGTGGGTGTGTAAGAAGGGAGG - Intronic
1106059050 13:26268246-26268268 GTGTGTGTGTGTTGGGGGAGGGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106230907 13:27820582-27820604 CCGTGGGTGGGAGGGGAGAGGGG - Intergenic
1106539783 13:30680003-30680025 CTGTGTGTGGGTAGGGACACCGG + Intergenic
1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG + Intergenic
1106686383 13:32064489-32064511 CTGACAGTGTGCAGGGAGAGAGG - Intronic
1106851209 13:33794719-33794741 CTGTGCATGTGTGGAGAGAGAGG - Intergenic
1106885334 13:34178537-34178559 CTGTGGATGTGTTGGGATAGGGG - Intergenic
1107134483 13:36928951-36928973 GTGTGTGTGTGTAGTGAGGGTGG + Intergenic
1108147669 13:47496723-47496745 CTGTGGGTGTGTGGAGGCAGGGG + Intergenic
1109032554 13:57210945-57210967 CTGTGTGTGTGTAGTGGTAGTGG + Intergenic
1109233405 13:59786751-59786773 GTGTATGTGTTTAGGGAGAGGGG + Intronic
1109592614 13:64505933-64505955 CTGTGTGTGTGTGTGGAGAAAGG - Intergenic
1109928726 13:69184037-69184059 ATGTGTGTGTGTGTGGAGAGGGG - Intergenic
1110157656 13:72337994-72338016 CTGTTGTGGGGTAGGGAGAGGGG - Intergenic
1110778308 13:79435217-79435239 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
1111415648 13:87940183-87940205 CTGTGGAGGTGTTGGGAGGGCGG + Intergenic
1111507440 13:89212043-89212065 GTGTGTGTGTGTTGGGGGAGAGG - Intergenic
1111669576 13:91312571-91312593 TTGTGTGTGTGTAGGGGGCGGGG - Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1111812283 13:93106046-93106068 CTGTTGGAGTGTAGGGGGTGGGG - Intergenic
1111860114 13:93693491-93693513 GTGTGTGTGTGTAGGGAGACAGG + Intronic
1111949239 13:94697362-94697384 ATGTATGTGTGTGGGGAGAGTGG + Intergenic
1112060016 13:95729399-95729421 ATGTGTGTGTGTATGGAGAGAGG - Intronic
1112426511 13:99306514-99306536 TTGTGTGTGTGTTGGGGGAGGGG - Intronic
1112439334 13:99414493-99414515 GTTTGGGTATGTAGGGTGAGTGG - Intergenic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1112851651 13:103713417-103713439 GTGTGAGTGTGTGGGGAGAAAGG - Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113343668 13:109451949-109451971 CTGTGCATGTGTAGGTAGGGTGG - Intergenic
1113416058 13:110129602-110129624 GGGTGGGTGTGCAGGGAGTGGGG + Intergenic
1113547624 13:111166366-111166388 CTGAGGGTGTTTGGGCAGAGGGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113743442 13:112726278-112726300 CAGTCTGTGTGCAGGGAGAGGGG + Intronic
1114255053 14:20994498-20994520 CTGTGAGTGTGTAGGAAGTTAGG - Intronic
1114519353 14:23323162-23323184 TTTTGGGTGTGGAGGGAGTGTGG + Intronic
1114801322 14:25779008-25779030 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1115003050 14:28444133-28444155 CTGTGTGTGGGGGGGGAGAGGGG + Intergenic
1115010996 14:28544551-28544573 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1115161787 14:30404644-30404666 CTGTTGGGGTGTAGGGGGATAGG - Intergenic
1115217530 14:31027105-31027127 TTGTGGGGGGGTTGGGAGAGGGG + Intronic
1115828033 14:37299283-37299305 CTGTTGTAGGGTAGGGAGAGGGG + Intronic
1116492034 14:45515958-45515980 CTGTGGTGGGGTGGGGAGAGGGG + Intergenic
1116950610 14:50875250-50875272 CCATGGGTGTGAAGGAAGAGGGG + Intronic
1117023917 14:51600565-51600587 CTGTGGGGGTGTAGGTACAAAGG - Intronic
1117187944 14:53260931-53260953 GTGTGTGTGTGTTGGCAGAGGGG + Intergenic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117394340 14:55293863-55293885 TTGTGTGTGTGTGTGGAGAGAGG + Intronic
1118177126 14:63451806-63451828 CTGTGCTTGTGCAGGGACAGGGG + Intronic
1118485009 14:66206449-66206471 CTGTGGTGGGGTGGGGAGAGGGG + Intergenic
1118682763 14:68260305-68260327 GTGTGTGTGTGTGTGGAGAGGGG + Intronic
1118866103 14:69704845-69704867 CTGTGTGTGTCCAGGGAGTGGGG + Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119427722 14:74546657-74546679 CGTTGGGTGTGTTGGGGGAGGGG + Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121331006 14:93049816-93049838 ATGTGGATGTGGAGGGACAGAGG + Intronic
1121414523 14:93770045-93770067 CTGTGGCTGTAGGGGGAGAGCGG - Intronic
1121775157 14:96585424-96585446 CTGTGTGTTGGTGGGGAGAGAGG + Intergenic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1123419607 15:20120845-20120867 GTGTGTGTGTGTAGAAAGAGAGG + Intergenic
1123432649 15:20231687-20231709 GTGTGTGTGTGTAGAGAGAGAGG - Intergenic
1123432657 15:20231785-20231807 GTGTGTGTGTGTAGAGAGAGGGG - Intergenic
1123528829 15:21127381-21127403 GTGTGTGTGTGTAGAAAGAGAGG + Intergenic
1123955757 15:25332776-25332798 CTGTGTATGTGTAGTGGGAGAGG + Intergenic
1124170078 15:27365033-27365055 GTGAGTGTGTGTAGAGAGAGAGG - Intronic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1125386385 15:39141383-39141405 GTGTGGGTGGGTGGGCAGAGCGG + Intergenic
1125485319 15:40107564-40107586 GTGTGTGTGTGTATGGGGAGGGG + Intronic
1125552314 15:40554729-40554751 GTTTGGATCTGTAGGGAGAGGGG + Intronic
1125875124 15:43137618-43137640 CTGTGGGAGGGTTGGGACAGTGG - Intronic
1125973502 15:43931425-43931447 GTGTGTGTGTGTTGGGAGTGGGG - Intronic
1125994038 15:44139288-44139310 GTGTGTGTGTGTAGAGAGAGGGG - Intronic
1127061836 15:55194793-55194815 GTGTGTGTGTGTAGAGACAGAGG - Intronic
1127485814 15:59416655-59416677 GTGTGGGTGTATAGAGAGAGAGG - Intronic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1129142382 15:73611832-73611854 CTGTATGTGTGTGGGGACAGGGG + Intronic
1129378925 15:75153639-75153661 ATGGGGGTGTGTGGGGGGAGGGG - Intergenic
1129557044 15:76521437-76521459 CTTTGGGAGGGTGGGGAGAGAGG + Intronic
1129657860 15:77536648-77536670 TTGTGTGTGTGTAGAGAGAGAGG + Intergenic
1129894278 15:79091857-79091879 GTGTGTGTGTGTCGGGGGAGGGG - Intergenic
1129934566 15:79438181-79438203 GTGTGGGTGTGTAGTGTGTGGGG + Intronic
1129934611 15:79438344-79438366 GTGTGGGTGTGTAGTGTGTGGGG + Intronic
1130039351 15:80391923-80391945 CTGTGTGTGTGGAGGGGTAGGGG + Intronic
1130219723 15:82009354-82009376 CTCTTGGTGTGTCAGGAGAGAGG - Intergenic
1130635527 15:85616125-85616147 TTGTGGGGGTGTGGGGATAGGGG - Intronic
1130975360 15:88769458-88769480 GTGTTGGTGGGTGGGGAGAGTGG - Intergenic
1131287858 15:91076969-91076991 CTGTGCATGTGTAGGGGGAGGGG - Intergenic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131772753 15:95758041-95758063 CTGTTGGTGGGTAGGGAGAAAGG + Intergenic
1132556340 16:574354-574376 CTGCGGCTGTGCCGGGAGAGAGG + Exonic
1132641743 16:981380-981402 GTGTGTGTGTGTCGGGGGAGGGG + Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132864355 16:2086178-2086200 CTGTTGCTCTGTGGGGAGAGGGG - Exonic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133052760 16:3126921-3126943 ATGTGTGTGTGTGGAGAGAGAGG - Intergenic
1133321857 16:4919061-4919083 CGGTGTGTGTGTGGGGAGGGGGG - Intronic
1134446922 16:14337969-14337991 CTGTGTTTGTGTGGGAAGAGGGG - Intergenic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1136513165 16:30751536-30751558 ATGAGGGTGACTAGGGAGAGAGG - Exonic
1136712189 16:32248277-32248299 GTGTGTGTGTGAAGGGGGAGGGG - Intergenic
1136755725 16:32681127-32681149 GTGTGTGTGTGAAGGGGGAGGGG + Intergenic
1136812388 16:33189245-33189267 GTGTGTGTGTGAAGGGGGAGGGG - Intergenic
1136818864 16:33299325-33299347 GTGTGTGTGTGAAGGGGGAGGGG - Intronic
1136825427 16:33355858-33355880 GTGTGTGTGTGAAGGGGGAGGGG - Intergenic
1136830493 16:33454629-33454651 GTGTGTGTGTGAAGGGGGAGGGG - Intergenic
1136851972 16:33619327-33619349 GTGTTTGTGTGTAGAGAGAGGGG + Intergenic
1136851979 16:33619409-33619431 GTGTGTGTGTGTAGAGAGAGAGG + Intergenic
1136851986 16:33619435-33619457 GTGTGTGTGTGTAGGGAGAGGGG + Intergenic
1136851989 16:33619457-33619479 GTGTGTGTGTGTAGAGAGAGGGG + Intergenic
1137253686 16:46758255-46758277 GTGTGTGTGTGGAGAGAGAGAGG - Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137777076 16:51065025-51065047 CTGTTGGTGAGTGGGGTGAGGGG - Intergenic
1138176434 16:54902363-54902385 CTGTTGGTGCATAGGGTGAGGGG - Intergenic
1138260878 16:55620952-55620974 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1139174030 16:64665182-64665204 GTGTGTGTGTATAGAGAGAGAGG - Intergenic
1139222238 16:65195439-65195461 CTGGGGCTGAGTAGGGAGAGGGG - Intergenic
1140263075 16:73397465-73397487 GCATGGGTGTGTAGAGAGAGAGG + Intergenic
1140553213 16:75890485-75890507 CTTTGACTGTGCAGGGAGAGGGG + Intergenic
1140893244 16:79303103-79303125 ATGTGTGTGTGTTGGGAGAGAGG + Intergenic
1140905016 16:79402513-79402535 CAGTGGGTGTGACGGGGGAGAGG + Intergenic
1141028308 16:80568361-80568383 GTGTGGTTGAGTGGGGAGAGTGG - Intergenic
1141028329 16:80568429-80568451 GTGTGGTTGAGTAGGGAGGGTGG - Intergenic
1141028361 16:80568531-80568553 GTGTGGGTGAGTGGGGAGAATGG - Intergenic
1141125823 16:81400283-81400305 CAGTGAGTGTGTGGGGAAAGGGG - Intergenic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141351965 16:83306302-83306324 GTGTGGGGGTGTCGGGAGCGGGG + Intronic
1141493929 16:84393735-84393757 CTATGGGTGTGGGGGGAGTGGGG + Intronic
1142155405 16:88530690-88530712 CTGCAGGGGTGTGGGGAGAGGGG - Intronic
1142185360 16:88692300-88692322 CTGTGGGTTTGTGGGGACTGGGG - Intergenic
1142287220 16:89176368-89176390 CTGTGGTTTTGCAGGGGGAGGGG + Intronic
1142303053 16:89270122-89270144 CTGTGGGTATTTGGGGAGCGTGG - Intronic
1142364370 16:89642131-89642153 CTGTGGATGTGGATGTAGAGTGG - Intergenic
1202990965 16_KI270728v1_random:12215-12237 GTGTGTGTGTGAAGGGGGAGGGG - Intergenic
1203057868 16_KI270728v1_random:941483-941505 GTGTGTGTGTGAAGGGGGAGGGG + Intergenic
1203113575 16_KI270728v1_random:1467813-1467835 GTGTTTGTGTGTAGAGAGAGGGG + Intergenic
1203113584 16_KI270728v1_random:1467879-1467901 GTGTGTGTGTGTAGAGAGAGGGG + Intergenic
1203113588 16_KI270728v1_random:1467925-1467947 GTGTGTGTGTGTAGAGAGAGGGG + Intergenic
1142495794 17:305679-305701 GTGTGGGCGTGGTGGGAGAGTGG - Intronic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143344383 17:6239321-6239343 CGGTGGGTGGGTGGGCAGAGGGG + Intergenic
1143393909 17:6576799-6576821 GTGTGTGTGTGTTGGGGGAGTGG - Intergenic
1143555182 17:7655504-7655526 CTGTGGGGGTGCAGGAAGATAGG - Intronic
1144583747 17:16475310-16475332 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145279216 17:21455928-21455950 CTTTGGGGGTGTGAGGAGAGTGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1146449716 17:32963114-32963136 GTGTGTGTGTGTATGGAGGGAGG + Intergenic
1146478131 17:33179632-33179654 CTGTGGGGTTGTAAGGAGGGTGG - Intronic
1146778751 17:35647388-35647410 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
1146828509 17:36046053-36046075 GTGTGTGTGTGTTGGGGGAGTGG + Intergenic
1146828625 17:36047239-36047261 CTGTGGTTGTGAGGGCAGAGGGG - Intergenic
1146949037 17:36893062-36893084 CTGTGGGTGGGATGGAAGAGAGG - Intergenic
1147191322 17:38739684-38739706 TTGGGGGTGTGGAGAGAGAGAGG + Intronic
1147222139 17:38941672-38941694 GTGTGTGTGTGTATTGAGAGGGG + Intronic
1147395600 17:40140307-40140329 GTGTGTGTGTGTTGGGGGAGGGG - Exonic
1147458355 17:40552748-40552770 CTGTGGAGGAGCAGGGAGAGAGG - Intergenic
1147485045 17:40804853-40804875 TGGTGAGTGTGCAGGGAGAGAGG + Intergenic
1148001138 17:44387934-44387956 AAGTGGGTGAGTGGGGAGAGTGG - Intronic
1148206865 17:45784648-45784670 CTGTGGGTGTGATGGGGGCGGGG + Intronic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148652732 17:49261197-49261219 CTGTATGTGTGTGGGGAGTGTGG - Intergenic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1148973347 17:51504396-51504418 TTGTGCATGTGTAGGGATAGAGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149961642 17:61116085-61116107 CTGTGGTAGGGTAGGGGGAGGGG + Intronic
1150221176 17:63496709-63496731 CTGGGAGTGGGTATGGAGAGTGG + Intronic
1150433324 17:65136264-65136286 CTGTGCGTGCGTGGGGAGAGGGG + Intergenic
1150678255 17:67263413-67263435 CTGTAGCTGAATAGGGAGAGAGG - Intergenic
1151007576 17:70455688-70455710 CTGTCAGTGGGTGGGGAGAGGGG - Intergenic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151283441 17:73092999-73093021 CTGTGTGTGTGTTGCGGGAGAGG + Intergenic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1152011084 17:77717785-77717807 GTGTGTGTGTGTGGAGAGAGAGG + Intergenic
1152383966 17:79957759-79957781 CTGTGCGTGTGGTGGGGGAGGGG + Intronic
1152590201 17:81208010-81208032 GTGTGGGTGTGTGGTGTGAGTGG - Intronic
1152616153 17:81338799-81338821 CTGTGGGGGTGTGGGGAGTGAGG + Intergenic
1152851646 17:82639964-82639986 CTGTGTGTGGGTCGGGAGGGTGG + Intronic
1153029596 18:701365-701387 CTGTGCCTGTGTGGGGACAGGGG + Intronic
1153030513 18:709246-709268 ATGGGAGTGTGTAGGGAGACCGG + Intronic
1153296999 18:3556205-3556227 CTGTGTGTGTGTCGGGGGAAGGG - Intronic
1153727560 18:7972305-7972327 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1154259798 18:12820693-12820715 CCGCGTGTGTGTAGGGAGGGGGG - Intronic
1154333407 18:13447988-13448010 CCGGGAGGGTGTAGGGAGAGGGG + Intronic
1155057126 18:22194712-22194734 ATGTGTGTGTGTTGGGAGGGGGG - Intronic
1155117451 18:22783705-22783727 CTGTGGGTGGGCAGGGGGAGGGG + Intergenic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155225414 18:23725499-23725521 CTGGGGGTGTGTGTGCAGAGAGG + Intronic
1155278109 18:24209847-24209869 CAGTGGCTGTCTACGGAGAGTGG + Intronic
1155836478 18:30592005-30592027 CTGGGGATGAGTAGGGAGAGAGG + Intergenic
1155842709 18:30666035-30666057 CTGTGAGTGTGTGGGAATAGGGG + Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157022449 18:43801925-43801947 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
1157061547 18:44296828-44296850 CTATGTGTTTGTAGTGAGAGTGG - Intergenic
1157269674 18:46262746-46262768 GTGTGGTGGGGTAGGGAGAGAGG + Intronic
1157403636 18:47406076-47406098 CTCAGTGTGTGTTGGGAGAGGGG - Intergenic
1157441846 18:47717553-47717575 CGTTGGATGTGTCGGGAGAGTGG + Intergenic
1157607816 18:48937296-48937318 GTGTGTGTGTGTAGGAAGTGAGG + Intronic
1157700657 18:49759924-49759946 GTGTGTGTGTGTAGGGGGTGGGG + Intergenic
1157868295 18:51205465-51205487 CTGTGTGTCTGTGTGGAGAGGGG + Intronic
1158073617 18:53503006-53503028 CTGTCGGTGGGTAGGGTGAAGGG - Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158804240 18:60950447-60950469 ATGTGGATGTGTTGGGAGGGGGG - Intergenic
1159036837 18:63285700-63285722 CTCTGAGTGTGTAGCGGGAGAGG + Intronic
1159220382 18:65455822-65455844 GTGTGTGTGTGTGTGGAGAGGGG + Intergenic
1160008357 18:75085349-75085371 ATGGGGGTGGGTAGGCAGAGTGG - Intergenic
1160507849 18:79437212-79437234 CTGTGCGTGTGAGGGGATAGTGG + Intronic
1160731323 19:642878-642900 CTGTGTGTGTGTATGGCGGGGGG - Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161126879 19:2562815-2562837 CTCTGAGTGGGGAGGGAGAGAGG + Intronic
1161220344 19:3115520-3115542 CTGTGGGGGTGTGGGGGGCGTGG + Intronic
1161290360 19:3490791-3490813 CTCTGAGTGTGTTGGGTGAGGGG - Intergenic
1161726029 19:5929575-5929597 CTGTGTGTGTGTGGGGCGGGAGG + Intronic
1162320977 19:9970455-9970477 CTGTGGGTGTGTGGGGTCTGTGG + Intronic
1162320993 19:9970508-9970530 CTGTGGGTGTGTGGGGTCTGTGG + Intronic
1163326296 19:16605551-16605573 CTGTGTGTGTGCAGTGAGTGGGG - Intronic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1163492184 19:17623445-17623467 CGCTGGGTGGGTGGGGAGAGGGG + Intronic
1163493006 19:17627941-17627963 CTGTGGGTGGGAACAGAGAGGGG + Intronic
1163510876 19:17734239-17734261 GGGGGGGTGTGTGGGGAGAGTGG - Intronic
1164223462 19:23219229-23219251 CTGTGTGTTTGCAGGCAGAGAGG + Intergenic
1164892020 19:31832067-31832089 CTGTGTGTGTTTATGTAGAGGGG + Intergenic
1165185068 19:34012167-34012189 CTGTGTGTGTGTGGGGGTAGAGG - Intergenic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1165729472 19:38135490-38135512 CCGTGGGAGTGTGTGGAGAGGGG - Intronic
1166077319 19:40421220-40421242 CTGCGGGTGCGCATGGAGAGAGG - Intergenic
1166099370 19:40562089-40562111 GTGAGGGAGTGTAGGGTGAGAGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166351533 19:42200957-42200979 CGTTGGGTGTGTAGAGAGAGGGG - Intronic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1166830830 19:45638828-45638850 GTGTGGGTGAGTGGGGAGATGGG - Exonic
1167032795 19:46974718-46974740 CTCTGGGGGTGAGGGGAGAGGGG - Intronic
1167189826 19:47977532-47977554 TTCTGGGTGTGTTAGGAGAGAGG + Intronic
1167580557 19:50339010-50339032 CTTTGTGTGTGTATGTAGAGGGG - Intronic
1167616289 19:50535984-50536006 CTGCGGGTGGGGTGGGAGAGTGG + Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1167677636 19:50897418-50897440 GTGTGTGTGTGGTGGGAGAGTGG - Intergenic
1167719451 19:51168398-51168420 CTGAGGGTGTGAATGGGGAGAGG + Intergenic
1167744179 19:51341145-51341167 CGGTGGGTGTGTATGGTAAGTGG - Exonic
1168408084 19:56121079-56121101 CTGGGGGTGGGTGGGGAGACTGG - Intronic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
1168458956 19:56538468-56538490 GGGTGGGTGTGTAGTCAGAGCGG + Intergenic
1168724281 19:58572305-58572327 ATGGGGCTGAGTAGGGAGAGAGG - Intronic
1202711506 1_KI270714v1_random:21819-21841 CTGGGGGTGTGTGTGGAGACTGG + Intergenic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925059174 2:878024-878046 GTGTGTGTGTGTAGGGGCAGGGG - Intergenic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
925291199 2:2749763-2749785 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291219 2:2749836-2749858 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291233 2:2749888-2749910 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291253 2:2749961-2749983 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291267 2:2750013-2750035 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925670598 2:6306106-6306128 CTGAGGGTGAGAGGGGAGAGAGG - Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925889049 2:8419070-8419092 CAGTGTGTGTGTTAGGAGAGGGG + Intergenic
926187913 2:10706130-10706152 CTGTGAGTGTGTAGGGGTAGTGG - Intergenic
926901018 2:17752710-17752732 CCATGGGTGTGTGGGTAGAGAGG - Intronic
927868803 2:26610364-26610386 CAGTGGGTGGGCAGGGGGAGAGG - Intronic
928053661 2:28028374-28028396 GTGTAGGTGTGTTGGGAGGGTGG - Intronic
928090616 2:28372133-28372155 CTGTGGTGGGGTAGGGGGAGCGG + Intergenic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928327200 2:30328842-30328864 GTGTGTGTGTGTTGGGAGTGGGG - Intergenic
928338695 2:30422559-30422581 CTGTGTGTGTGTTGGGGGCGGGG - Intergenic
928455156 2:31414019-31414041 CTGTGTGTGGGTGGGGAGTGGGG + Intronic
928478677 2:31657830-31657852 CTGTGGGTGTGAAGAGTGTGTGG + Intergenic
928588586 2:32789427-32789449 CTGTAAATGTGTAGGGAGAGAGG + Intronic
928952369 2:36824444-36824466 TTATGGATGTGTAGGGGGAGGGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929457797 2:42078323-42078345 GTGGGGGTGTATAGGAAGAGTGG - Intergenic
929579909 2:43075382-43075404 CTGTGTGTGTGTCTGAAGAGAGG - Intergenic
929811643 2:45193662-45193684 GTGGGGGTGTGTGGGAAGAGAGG + Intergenic
930896993 2:56458135-56458157 GTGTGTGTGTGTGTGGAGAGAGG - Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931632897 2:64317219-64317241 CTGTGAGTGTGTATGGGGGGTGG - Intergenic
931683082 2:64768742-64768764 ATGTATGTGTGTAGGGAGAGAGG - Intergenic
931693834 2:64857844-64857866 CTGTGGGTGTGAAGACAGTGGGG + Intergenic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
932567594 2:72919170-72919192 GTGTGTGTGTGTAGGGCCAGTGG - Intronic
932568304 2:72923469-72923491 CAGTGTGTGTGTTGGGATAGGGG + Intronic
932944950 2:76218007-76218029 CTTTTGGTGTGTAGCAAGAGTGG + Intergenic
933608270 2:84407054-84407076 TTGTGTGTGTGTTGGGGGAGGGG - Intergenic
933780893 2:85800162-85800184 CAGTGAGTGTGGAGGCAGAGAGG - Intergenic
934578445 2:95418260-95418282 GTGTGTGTGTGTAAGGAAAGAGG + Intergenic
934686392 2:96325184-96325206 CCGTGGGTTTGCTGGGAGAGTGG - Intergenic
934897209 2:98129247-98129269 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
934949836 2:98568789-98568811 GTGTGTGTGTTTAGGGAGAAAGG - Intronic
934981825 2:98849425-98849447 CTGTGGGTGGGTGTGCAGAGGGG + Intronic
935318088 2:101857710-101857732 CTGGGGGGGTGTGGGCAGAGGGG - Intronic
935368048 2:102315279-102315301 CTGTGGGTAGACAGGGAGAGTGG - Intronic
935467877 2:103420857-103420879 GTGTGTGTGTGTTGGGGGAGGGG + Intergenic
935552700 2:104475235-104475257 CTGTGGGTCTGTGGGGACAGAGG - Intergenic
935596411 2:104881566-104881588 GTGTATGTGTGTAGAGAGAGAGG - Intergenic
935622314 2:105141006-105141028 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
936373353 2:111921047-111921069 CTGTGGGGGTAAAGGGAGTGGGG + Intronic
936892956 2:117393395-117393417 CTGTGGGTGTCTCTGGAAAGAGG - Intergenic
937436019 2:121881998-121882020 ATGTGTGTGTGTAGGTTGAGGGG + Intergenic
937778154 2:125805683-125805705 CTCTGGGGGTGGAGGGTGAGTGG + Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
938192313 2:129294992-129295014 GTGTGTGTGTGCAGAGAGAGTGG + Intergenic
938241201 2:129743537-129743559 GTGTGTGTGTGTAGGGGGAGTGG - Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
938905124 2:135829845-135829867 GTGTGTGTGTGTAGGGGGCGGGG + Intronic
939136999 2:138308788-138308810 TTGTGGGTGTCATGGGAGAGGGG - Intergenic
939320023 2:140607622-140607644 GTGTGTGTGTGTAAAGAGAGGGG - Intronic
940632838 2:156260376-156260398 CTGTGGTTGGGTTGGGGGAGCGG + Intergenic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
940714302 2:157201954-157201976 CTGTGTGTGTGTGGTGATAGGGG + Intergenic
941485707 2:166078477-166078499 CTCTGCGTGTGTAGAGAAAGGGG + Intronic
941571826 2:167179889-167179911 CTTTGGGTGTGTGGGGCGAAAGG - Intronic
941928842 2:170921546-170921568 GTGTGTGTGTGTTGGGGGAGGGG - Intergenic
942453366 2:176122255-176122277 GTGGGTGTGAGTAGGGAGAGAGG + Intergenic
942628047 2:177924876-177924898 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
942769873 2:179504023-179504045 CTGTGGTGGGGTGGGGAGAGGGG - Intronic
943044031 2:182837071-182837093 GTGTGGGTGGGTGGGGGGAGTGG - Intronic
943097533 2:183448454-183448476 CTGTTGTGGTGTGGGGAGAGCGG - Intergenic
943434886 2:187852776-187852798 CTTTGCATGTGTTGGGAGAGAGG - Intergenic
943627980 2:190219854-190219876 CTGTGGGTTTGGATGGACAGAGG + Intronic
943888003 2:193247923-193247945 CTGTGTGTGTGTCTGGAGATGGG - Intergenic
944014560 2:195019558-195019580 GTGTGTGTGTGTATGGAGGGGGG - Intergenic
944193079 2:197024021-197024043 CTGTGAGTATGTGGGGAGACAGG + Intronic
944261965 2:197687681-197687703 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
944340119 2:198586094-198586116 CTGTGGTGGTGTGGGGGGAGGGG + Intergenic
944539610 2:200743167-200743189 CTGTGGCTGAGTTGGGAAAGCGG - Intergenic
945460882 2:210106859-210106881 CTGTTGGAGTGTGAGGAGAGTGG + Intronic
945516946 2:210774189-210774211 CTGTTGTGGGGTAGGGAGAGGGG + Intergenic
945769817 2:214029329-214029351 GTGTTGGTGGGTAGGAAGAGTGG + Intronic
945798491 2:214394643-214394665 CTGTGCATGTGTGGGGATAGGGG - Intronic
945958059 2:216104882-216104904 CTTTGTGTGAGTGGGGAGAGAGG + Intergenic
946054746 2:216890982-216891004 CTTTTGGGGAGTAGGGAGAGAGG + Intergenic
946088136 2:217195165-217195187 GTGTGTGTGTGTAGGGGGTGGGG - Intergenic
946182918 2:217959809-217959831 CTCTGTGGGTGGAGGGAGAGAGG + Intronic
946308873 2:218871902-218871924 GTGAGGGTGTGTAGGTGGAGGGG + Intronic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946735088 2:222745876-222745898 GTGTGTGTGTGTGGGGAGGGGGG - Intergenic
946772627 2:223104511-223104533 CTGCGGGTGGTGAGGGAGAGAGG + Intronic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
946904971 2:224407148-224407170 GTGTGTGTGTGTTGGGAGAAGGG - Intergenic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947132957 2:226948411-226948433 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
947377048 2:229506666-229506688 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
947468854 2:230381701-230381723 GTGTGTGTGTGTAGAGAGACAGG - Intronic
947921212 2:233876039-233876061 CTGTGCATGTGTGGGGACAGGGG - Intergenic
948300517 2:236903333-236903355 GTGTGTGTGTGTAGGGAGATGGG + Intergenic
948831488 2:240600533-240600555 CTGTGGGTGAGTCAGGAGGGTGG - Intronic
1168935234 20:1659382-1659404 CTGTGGGTGTGGAGAAGGAGGGG - Intergenic
1168961252 20:1871496-1871518 GTGTGTGTGTGTGTGGAGAGGGG - Intergenic
1169112893 20:3044831-3044853 CTGCTGGTGAGTAGGGTGAGAGG + Exonic
1169130383 20:3163798-3163820 CTGTGTGTGTGTTGCGGGAGGGG - Exonic
1169221305 20:3824624-3824646 CTGTGGGTTTGGAAGAAGAGCGG - Exonic
1169811708 20:9615405-9615427 CTGTGCATGTGTAGGGGCAGGGG + Intronic
1169902981 20:10571589-10571611 CAGAGGGTGAGCAGGGAGAGAGG - Intronic
1169927592 20:10799133-10799155 CTCTGTGTGTGTTGGGGGAGGGG + Intergenic
1170339495 20:15307482-15307504 ACGTGTGTGTGTAAGGAGAGAGG - Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170457744 20:16549187-16549209 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1170824916 20:19785265-19785287 GTGTGTGTGTGTATGTAGAGGGG - Intergenic
1170930612 20:20766998-20767020 CTGTGGGGGTCTGGGGAAAGGGG - Intergenic
1171127183 20:22612838-22612860 CTGTTTGTGGGTAGGGAGTGAGG + Intergenic
1171168861 20:22997692-22997714 GTGTGTGTGTGTAAGGGGAGGGG + Intergenic
1171188381 20:23139979-23140001 CTGTGGTGGTGTGGGGGGAGGGG + Intergenic
1171823563 20:29876019-29876041 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1171896527 20:30814326-30814348 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1172821505 20:37738922-37738944 CTGTGGATGAGAAGGCAGAGTGG + Intronic
1173095858 20:40027570-40027592 GTGTGTGTGTGTAGGGAGACTGG + Intergenic
1173195018 20:40906992-40907014 GTGTGTGTGTGTATGGGGAGGGG - Intergenic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174426803 20:50437517-50437539 CTGTGCCTGTGTCGGGGGAGGGG + Intergenic
1175267503 20:57711384-57711406 CTGTGCCTGTGCAGGGAGAGCGG - Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175605488 20:60308861-60308883 GTGTGTGTGTGTAGAGAAAGAGG - Intergenic
1175696482 20:61106543-61106565 CTGAGGATGTGCAGGAAGAGGGG - Intergenic
1175998336 20:62821211-62821233 CTGGGGGTGAGTATGGAGTGTGG + Exonic
1176736407 21:10551280-10551302 CTGTTGTTGGGTAGGGGGAGGGG + Intronic
1176960596 21:15154747-15154769 TTGTGTGTGTGTTGGGGGAGGGG + Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1177683287 21:24403106-24403128 CTGTGCATGTGTGGGGACAGGGG + Intergenic
1178533272 21:33392672-33392694 CTGGGTGTGTGTTGGGAGGGGGG + Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178890203 21:36514651-36514673 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1178893580 21:36540961-36540983 CAGTGGCTGTGGAGGGGGAGAGG + Intronic
1178961959 21:37073461-37073483 CCGTGGGTGTGTGGTGAGTGTGG + Intronic
1179286977 21:39985942-39985964 GTGTGTGTGTGTAGTGTGAGGGG - Intergenic
1179492905 21:41752817-41752839 CTGTCGGTGCGTAGGGGAAGAGG + Intronic
1179542657 21:42093660-42093682 ATGAGGCTGTGTGGGGAGAGCGG + Intronic
1179788457 21:43742351-43742373 TTGTGGGTGTGTGTGGAGACAGG + Intronic
1179881274 21:44294253-44294275 GTGTGGGTGTGGGTGGAGAGTGG - Intronic
1179881433 21:44294798-44294820 CTGGTGGGGTGAAGGGAGAGCGG + Intronic
1179884271 21:44306771-44306793 CTGTGTGTGTGCAGGGAGTGGGG + Intronic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180204300 21:46248098-46248120 ATGTGGGTGTGTAAGGAGTCAGG + Intronic
1180338301 22:11598945-11598967 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1180340555 22:11614362-11614384 ATGAGGGTGTGTGGGGGGAGGGG + Intergenic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1181750477 22:24985758-24985780 GTGTGTGTGTGTATGGTGAGGGG + Intronic
1182067323 22:27439819-27439841 CTCTGGGGCTGCAGGGAGAGCGG - Intergenic
1182149928 22:28020768-28020790 GTGTGTGTGTGTTGGGGGAGGGG - Intronic
1182204703 22:28611655-28611677 CTGTGGTGGGGTAGGGGGAGCGG - Intronic
1182640372 22:31762137-31762159 CTCTGGGTGAGTAGGGATTGGGG + Intronic
1183456240 22:37924780-37924802 CTGGGGCCGGGTAGGGAGAGAGG + Intronic
1183480893 22:38064979-38065001 CTGTGGGTGCATAAGGAGAGTGG - Intronic
1183520374 22:38293323-38293345 TTGAGGGTGGGGAGGGAGAGAGG + Intronic
1183532736 22:38371430-38371452 CTGTTGTTGAGTAGGGGGAGGGG - Intronic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1183777861 22:39979359-39979381 CTATGCGTGTGTGGGGACAGGGG + Intergenic
1184189996 22:42888062-42888084 CTCTGCTTGTGTAGGGAGAGGGG - Intronic
1184207415 22:43014311-43014333 GTGTGTGTGTGTAGGGCGGGGGG - Intronic
1184335920 22:43853191-43853213 CTGTGTGTGTGTAGTGTGTGTGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184786506 22:46674529-46674551 CTGTGGGTGTGACGTGAGCGCGG + Intronic
1184822188 22:46917731-46917753 ATGTGTGTGTCTGGGGAGAGTGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1184992837 22:48182254-48182276 CCTTGGCTCTGTAGGGAGAGAGG - Intergenic
1185323854 22:50216126-50216148 CTCTGGGTTTCTAGGGAGAATGG + Intronic
1185351014 22:50338523-50338545 CGGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351043 22:50338812-50338834 GTGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351063 22:50338952-50338974 TGGTGGGTGTGTAGGGTGTGTGG + Intergenic
949376905 3:3400789-3400811 ATGTGGGGGAGTGGGGAGAGTGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949740643 3:7229706-7229728 ATGTGTGTGTCTATGGAGAGCGG - Intronic
949881453 3:8664133-8664155 CTGTGTTTCTCTAGGGAGAGAGG + Intronic
950103282 3:10371546-10371568 CTGTGTGTGGGCAGGGGGAGTGG + Intronic
950116971 3:10457214-10457236 GTGTGGGTGTGTAGGGTGTATGG + Intronic
950116984 3:10457305-10457327 GTGTGGGTGTGCAGGGTCAGTGG + Intronic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
950649974 3:14401248-14401270 CTGGGGCTGTACAGGGAGAGTGG + Intergenic
951052066 3:18105052-18105074 GTGTGTGTGTGCTGGGAGAGGGG + Intronic
951397495 3:22187465-22187487 GTGTGTGTGTATAGGGTGAGAGG - Intronic
951658047 3:25031237-25031259 ATATGGGTGTATGGGGAGAGGGG - Intergenic
952498403 3:33936159-33936181 CTGTGTGTGTGTGTGGAGTGGGG + Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953188226 3:40658207-40658229 ATGTGTGTGTGTGAGGAGAGAGG + Intergenic
953865780 3:46582029-46582051 CTGCGTGTGTGCAGGGAGACTGG + Exonic
953934757 3:47031339-47031361 TTGTGCGTGTGTAGTGACAGGGG + Intronic
954439347 3:50513164-50513186 GTGTGCGTTTGTTGGGAGAGGGG - Intergenic
954880220 3:53830838-53830860 CTGTGGGGGTGGGGGGCGAGGGG - Intronic
955751827 3:62191307-62191329 CATTGTGTGTGTAGAGAGAGAGG - Intronic
955937029 3:64111993-64112015 GTGTGTGTGTGTTGGGATAGGGG - Intronic
955947755 3:64211544-64211566 CTGTGTGTGTGGAAAGAGAGAGG + Intronic
956867107 3:73380716-73380738 CTGTGGGGGGGTGGGGGGAGGGG - Intergenic
957014848 3:75051128-75051150 TTGTGCATGTGTGGGGAGAGTGG + Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958724630 3:97889562-97889584 CTATGGCTGTGAATGGAGAGTGG + Intronic
958848893 3:99298195-99298217 CTGTTGTAGGGTAGGGAGAGGGG + Intergenic
959331947 3:105017472-105017494 CTGTGCATGTGTAGGGACAGGGG + Intergenic
959633047 3:108530657-108530679 CTATGCATGTGTAGGGACAGGGG + Intergenic
959863899 3:111244253-111244275 GTGTGTGTGTGTAGGGTGGGAGG + Intronic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
959979090 3:112494747-112494769 CTGTTGGGGAGTAGGGGGAGAGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960401295 3:117202290-117202312 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
960529100 3:118743298-118743320 CAGTGGGGGTGAAGGGATAGTGG - Intergenic
960836417 3:121911275-121911297 CTGTGTGTGTGTGGAGTGAGCGG + Intronic
960963300 3:123087775-123087797 CTGTGAGTGTGTGGAGGGAGTGG + Intronic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961037572 3:123653228-123653250 GTGTGTGTGTGTTGGCAGAGAGG - Intronic
961091609 3:124117623-124117645 CAGTGTGTGTGTCGGGGGAGTGG + Intronic
961675025 3:128559567-128559589 CTGAGGGTGAGTGGGGAGATCGG - Intergenic
962070884 3:132033417-132033439 GTGTGTGTGTGTAGAGGGAGAGG + Intronic
962712987 3:138103074-138103096 CTGTGTGTATGTAGGGTGTGTGG - Intronic
962820237 3:139041743-139041765 CTGTCGGTGGGTGGGGAGATAGG + Intronic
962872897 3:139513569-139513591 GTGTGTGTGTGTAGAGAGAGGGG + Intergenic
962927867 3:140011842-140011864 CAGTGGGTGTGGGGTGAGAGTGG + Intronic
963116497 3:141734699-141734721 GTGTGTGTGTGTTGGGGGAGTGG + Intergenic
963215021 3:142735782-142735804 GTGTGTGTGTGTTGGGAGGGTGG + Intronic
963838888 3:150084756-150084778 GAGTGGGAGGGTAGGGAGAGTGG - Intergenic
964289652 3:155163180-155163202 CTATGTGTGTGTATGGAGGGAGG - Intronic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
965795954 3:172438850-172438872 CTGTGGGTGTGTGGAGTGGGGGG - Intergenic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966371441 3:179254222-179254244 CGGTGTGGGTGAAGGGAGAGGGG - Intronic
966495325 3:180573560-180573582 GTGTGTGTGTGTATAGAGAGAGG - Intergenic
966656132 3:182360515-182360537 GTGTGTGTGTGTAGGGGGAAAGG + Intergenic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967702272 3:192607000-192607022 CTGCGTGTGTGTTGGGGGAGGGG - Intronic
968194348 3:196694645-196694667 GTGTGGGTGTGTAGTGTGTGGGG - Intronic
968194391 3:196694814-196694836 GTGTGGGTGTGTAGTGGGTGGGG - Intronic
968194414 3:196694897-196694919 GTGTGGGTGTGTAGTGGGTGTGG - Intronic
968194429 3:196694962-196694984 GTGTGGGTGTGTAGTGGGTGTGG - Intronic
968194537 3:196695474-196695496 GTGTGGGTGTGTGGGGTGTGTGG - Intronic
968194548 3:196695517-196695539 GTGTGGGTGTGTGGGGTGTGTGG - Intronic
968603875 4:1522420-1522442 CTGTGGCTGTGACGGGACAGAGG - Intergenic
968765527 4:2466649-2466671 GTGTGTGTGTGTGTGGAGAGGGG + Intronic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
968817065 4:2827702-2827724 CTCTGGGTGTGTAGGAAGCAGGG + Intronic
968879103 4:3289808-3289830 CTGTGGGTGGGTAGGAATTGGGG - Intergenic
969035395 4:4249347-4249369 GTGTGGGAGAGCAGGGAGAGTGG + Intergenic
969448073 4:7256747-7256769 CTATGGGGGTGTCGGGAAAGGGG + Intronic
969451630 4:7277120-7277142 CTTTGGCTGTGTATGGAGGGTGG + Intronic
969554373 4:7896558-7896580 CCCTGGGTGTGTGGGGAGTGAGG - Intronic
969554391 4:7896616-7896638 CCCTGGGTGTGTGGGGAGTGAGG - Intronic
969554409 4:7896674-7896696 CCCTGGGTGTGTGGGGAGTGAGG - Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
970143051 4:13003507-13003529 GTGTGTGTGTGTGGGGGGAGGGG + Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970297107 4:14641869-14641891 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
970405917 4:15764136-15764158 CTGTGCATGTGTAGGGAGAAGGG + Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971494085 4:27245847-27245869 GTGTGTGTGTGTAGGGACAGAGG + Intergenic
971700862 4:29973544-29973566 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
972469512 4:39390223-39390245 TTGTGTGTGTGGAGAGAGAGAGG - Intergenic
972852863 4:43072061-43072083 CTGGGGGTGGGTAGGGAGTTAGG + Intergenic
973546874 4:51991040-51991062 CTGTGAGTGGGTAGGGTTAGGGG + Intergenic
973644074 4:52932742-52932764 TTGTGTGTGTGTTGGGGGAGGGG - Intronic
973663263 4:53130581-53130603 GTGTGTGTGTAGAGGGAGAGGGG - Intronic
973663265 4:53130583-53130605 CTGTGTGTGTGTAGAGGGAGAGG - Intronic
974265293 4:59579683-59579705 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
974767975 4:66372643-66372665 CTGGGGGTGTGTGGGGGGTGGGG - Intergenic
975000592 4:69220443-69220465 GTGTGGGTGTGTTGGGGGTGGGG + Intergenic
975005178 4:69274756-69274778 GTGTGGGTGTGTTGGGGGTGGGG - Intergenic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975196578 4:71531744-71531766 GTGTGTGTGTGTAGGCAGGGAGG - Intronic
975252463 4:72196213-72196235 CTGTTGTGGGGTAGGGAGAGGGG - Intergenic
975930373 4:79514462-79514484 GTGTGTGTGTGTTGGGGGAGGGG - Intergenic
976352720 4:84078351-84078373 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
976609904 4:87019625-87019647 ATGTGGAGGTTTAGGGAGAGTGG + Intronic
976846827 4:89498331-89498353 GTGTGTGTGTGTATGGAGACGGG + Intergenic
976879531 4:89902170-89902192 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977504261 4:97882016-97882038 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
978129560 4:105178652-105178674 TTGTGGGTCTGTGGGGACAGGGG + Intronic
978137611 4:105281510-105281532 CTGTGAGTGTATTGGGGGAGGGG - Intergenic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
979416829 4:120451791-120451813 GTGTGTGTGTGTTGGGGGAGGGG + Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980443667 4:132880434-132880456 ATGAGGGTGTGAAGGGAAAGTGG + Intergenic
980794471 4:137663164-137663186 CAGTGGGTGGGGAGAGAGAGTGG - Intergenic
980986093 4:139695878-139695900 CTGTGTGTGTGTGGGGCGGGGGG - Intronic
981296563 4:143140061-143140083 CTGTGGGTGTCTAGCAAGATGGG + Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981969881 4:150654690-150654712 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
982062707 4:151620855-151620877 TTCTCGGTGTGTAGGGAGGGTGG - Intronic
982367539 4:154596492-154596514 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
982807302 4:159782421-159782443 CTGTGCATGTGTGGGGATAGAGG - Intergenic
983726756 4:170939111-170939133 CTGTGAATGAGTAGAGAGAGAGG + Intergenic
984120724 4:175738841-175738863 CAGATGGTGTGTAGGGAGGGTGG - Intronic
984370475 4:178858686-178858708 CTGTGGTGGGGTAGGGGGAGTGG - Intergenic
984521089 4:180801707-180801729 ATGTGTGTGTGTAGGGTGGGGGG + Intergenic
984716778 4:182933392-182933414 CTGTGAGTCTCAAGGGAGAGAGG - Intergenic
984965249 4:185134216-185134238 GTGTGTGTGTGTAGAGACAGGGG + Intergenic
985445035 4:190017207-190017229 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985573237 5:661943-661965 CTGGAAGTGTGGAGGGAGAGTGG + Exonic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985683612 5:1270405-1270427 CTGTGTGTGCCTGGGGAGAGTGG - Intronic
985750079 5:1668495-1668517 CTGCGGCTGTGTTGGGGGAGGGG + Intergenic
985974946 5:3410888-3410910 GTGTGTGTGTGTAGAGAAAGAGG - Intergenic
986176465 5:5356416-5356438 CGGGGGGTGTGCAGGGGGAGGGG - Intergenic
986598816 5:9450614-9450636 CTGTGGCTGACTGGGGAGAGGGG - Intronic
986607340 5:9535466-9535488 TCGTGGGTGGGTTGGGAGAGTGG - Intronic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
987195876 5:15525598-15525620 CTGTGTGTGTGTGGGGGGTGGGG + Intronic
987303662 5:16618034-16618056 CTGGGTGAGTGTGGGGAGAGAGG + Intergenic
987348941 5:17004266-17004288 GTGTGGGTGTTTGGGGAGGGGGG - Intergenic
987474128 5:18369695-18369717 GTGTGGGAGTCTATGGAGAGCGG + Intergenic
987770843 5:22302226-22302248 CTGTGTGTGTGTATGTAGAGCGG - Intronic
987997350 5:25301802-25301824 GTGTGTGTGTGTAGGAAAAGGGG + Intergenic
988506128 5:31825038-31825060 GTGGGCGTGTGTAGGGAGACAGG - Intronic
988636883 5:32994543-32994565 GTGTGTGTGTGTAGAGAGGGAGG - Intergenic
988832926 5:35004788-35004810 CTGAGGGTGGGTAGGAAGTGTGG - Intronic
989034672 5:37157566-37157588 CAGTGGGTTTGTAGGAGGAGAGG + Intronic
989108895 5:37888513-37888535 CTGAGGGTGGGTATGAAGAGTGG + Intergenic
989712574 5:44417622-44417644 GTGTGTGTGTGTAGAAAGAGAGG - Intergenic
990008186 5:50966490-50966512 GTGTGTGTGTGTAGGGGGTGGGG + Intergenic
992122635 5:73610441-73610463 CTGTGTGTGTTTGGGGAGATGGG + Intergenic
992204311 5:74415412-74415434 CTGTGTGTGTGTAAAGGGAGGGG - Intergenic
992319364 5:75595813-75595835 GTGTGCATGTGTAGGGAAAGGGG + Intronic
992412185 5:76516609-76516631 ATGTGCGTGTGTTGGGGGAGGGG + Intronic
992504990 5:77377999-77378021 GTGTGTGTGTGTAGAGAGAGAGG - Intronic
993038230 5:82781986-82782008 GTGTGTGTGTGTAGGGAGTGTGG + Intergenic
993245249 5:85442763-85442785 CTGAGGGTGGGTGTGGAGAGAGG + Intergenic
994084000 5:95738946-95738968 CTGTGTGTGTGTGGGAGGAGGGG - Intronic
994141264 5:96344126-96344148 TTTTGGGTGTGTAGGAAGACTGG + Intergenic
994177851 5:96731649-96731671 CTGTGGAGGGGTGGGGAGAGGGG - Intronic
994952254 5:106479347-106479369 CTGTTGGGGGGTAGGGGGAGAGG + Intergenic
995052981 5:107727388-107727410 TTGTGCGTGTGTAGGGAGAGGGG + Intergenic
995403925 5:111772635-111772657 CTGTTGGTGTCTCGGGGGAGGGG - Intronic
995709100 5:115016539-115016561 CTGTGCATGTGTGGGGAGAGGGG + Intergenic
995761977 5:115572723-115572745 CTGTCTGTGTCTAGGGAGAGAGG - Intergenic
996090915 5:119350968-119350990 GTGTGTGTGTGTAGAGAGAGGGG + Intronic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996597916 5:125226524-125226546 GTGTGTGTGTGATGGGAGAGAGG + Intergenic
996826225 5:127684104-127684126 CTGTGTGTGTGCAGAGAAAGAGG + Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996909549 5:128639580-128639602 CTGTGGTTGAGTAGGAGGAGTGG - Intronic
997311261 5:132885475-132885497 GGGTGGGTGGGTGGGGAGAGGGG + Intronic
997470020 5:134112483-134112505 GGGTGGGTGAGTAGGGAGAGTGG - Intergenic
997783519 5:136684501-136684523 GTGTGCATGTGTTGGGAGAGGGG + Intergenic
998103421 5:139452568-139452590 GTGTGGGTGTGTGGGGGGTGTGG + Intronic
998106559 5:139472743-139472765 CGGTGGCTCTGTAGGGAGAGTGG - Intergenic
998311125 5:141133378-141133400 CTGTGCTTGTGTGGGGACAGGGG + Intronic
998459906 5:142302318-142302340 CGGTTGGTGTATAGGGGGAGAGG - Intergenic
999248627 5:150168313-150168335 CTGGGTGTGTGTGGGGAGATGGG - Intronic
999647179 5:153729228-153729250 CTGTTGTGGGGTAGGGAGAGGGG + Intronic
999651661 5:153774069-153774091 GTGTGTGTGTGTGGGGGGAGGGG - Intronic
999834243 5:155352337-155352359 CTGGAGGTCTGTAGTGAGAGTGG - Intergenic
1000002545 5:157152682-157152704 CTGTGAGTGTGTGGGGGGAGCGG - Intronic
1000796368 5:165670008-165670030 CTGTGTGTGTGTCGGGGGTGGGG - Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001428847 5:171643896-171643918 GTGTGTGTGTGTAGGGGGAGAGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001738451 5:174027855-174027877 GTGTGTGTTTGTAGGGAAAGGGG + Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1002160365 5:177311215-177311237 GTGTGAGTGTGTTTGGAGAGTGG + Intronic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002261832 5:177998581-177998603 CTGTCTGTGTATTGGGAGAGTGG - Intergenic
1002473716 5:179452410-179452432 CTGTGGATGTGTAGGAGCAGGGG - Intergenic
1002644352 5:180645898-180645920 TTGGGGGTGGGCAGGGAGAGGGG - Intronic
1202772925 5_GL000208v1_random:30026-30048 CTGTGGTTGGGTGGGGGGAGGGG - Intergenic
1002923665 6:1592309-1592331 GTGTGTGTGTGTGTGGAGAGGGG - Intergenic
1002936596 6:1679071-1679093 CTGTGTGTGTGCGGAGAGAGAGG - Intronic
1002999324 6:2316811-2316833 CTGTGTGTGTGTGTGGAGGGTGG + Intergenic
1003110752 6:3250380-3250402 CTGTGCTTGTGAAGGGTGAGTGG + Intronic
1003320108 6:5043804-5043826 CTTTGGGTGATTAGGGAAAGTGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003687489 6:8318745-8318767 ATGTGTGTATGGAGGGAGAGGGG - Intergenic
1003874438 6:10423623-10423645 GTGTGTGTGTGTTGGGGGAGGGG + Intergenic
1004613825 6:17270822-17270844 GTGTGTGTGTGTAAGGAAAGTGG + Intergenic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005990214 6:30897690-30897712 GTGGGGGTGGGAAGGGAGAGAGG + Intronic
1006007483 6:31013944-31013966 CAGTAAGTGTGTAGGGGGAGTGG - Intronic
1006118991 6:31792631-31792653 CTGCGGGAGAGGAGGGAGAGGGG - Intronic
1006134059 6:31885017-31885039 CTGTGGGTGGGAAGGGAGTGAGG + Intronic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006179599 6:32146879-32146901 CTGTGTGTGTGTCGGGGGAAGGG + Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006667401 6:35705703-35705725 CTGGGGGTGAGGAGGGTGAGGGG + Intronic
1007175392 6:39892863-39892885 GTGTGTGTGTGTAGTGTGAGGGG - Intronic
1007178828 6:39913878-39913900 CTGTGGGGGTGTGGGGGAAGAGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007490353 6:42216402-42216424 GTGTGTGTGTGTTGGGGGAGTGG + Intronic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1008023512 6:46607454-46607476 GTGTGTGTGTGTAGGGGGAAGGG - Intronic
1009438103 6:63641414-63641436 CTGTGGGTGTGTGTGTAGGGGGG - Intronic
1009569129 6:65358628-65358650 GTGTGTGTGTGTTGGGAGAAGGG + Intronic
1010020839 6:71158232-71158254 GTGTGTGTATGTAGGGGGAGGGG + Intergenic
1010207970 6:73339826-73339848 GTGTGTGTGTGTAGGGGTAGGGG - Intergenic
1010444919 6:75939009-75939031 CTTTGTGTGTGTAGAGACAGGGG + Intronic
1010531716 6:76976724-76976746 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
1010637918 6:78283328-78283350 CTGTGGGTTTTTGGGGACAGGGG + Intergenic
1010972403 6:82276837-82276859 GTGTGTGTGTGTAGGCAGGGAGG + Intergenic
1010982234 6:82381380-82381402 GTGTGTGTGTGTCAGGAGAGAGG + Intergenic
1011391117 6:86854758-86854780 CAGTGTGTGTGTGTGGAGAGGGG - Intergenic
1011624407 6:89271567-89271589 CTGTGCCTGTGTGGGCAGAGCGG - Intronic
1011625742 6:89282190-89282212 CTGTGGGTGTGGTGGAGGAGGGG - Intronic
1011992844 6:93545711-93545733 CTGTTGTTGGGTGGGGAGAGTGG - Intergenic
1011999073 6:93631736-93631758 CTGTGGTGGGGTGGGGAGAGGGG - Intergenic
1012033117 6:94098463-94098485 CTGAGAGTGGGTAGGTAGAGAGG - Intergenic
1012276851 6:97284472-97284494 GTGTGTGTGTGCAGAGAGAGAGG - Intergenic
1012541119 6:100363050-100363072 ATGTGTGTGTGTGGGGAGAGGGG - Intergenic
1012793417 6:103730332-103730354 GTGTGTGTGTGTAGGGGGAGAGG - Intergenic
1013117962 6:107116231-107116253 CAGTGGCTGGGTAGGGGGAGGGG + Intergenic
1013129330 6:107216772-107216794 ATGTGTGTGTGTTGGGGGAGGGG + Intronic
1013261621 6:108449748-108449770 CTGTTGTTGGGTGGGGAGAGGGG - Intronic
1013696596 6:112709610-112709632 CTGTGGTTGGGTCGGGGGAGGGG + Intergenic
1013712158 6:112914513-112914535 CTGTGGTTGGGTCGGGGGAGGGG - Intergenic
1013713257 6:112926692-112926714 CTGTGAGGGAGTAGGGAGACAGG - Intergenic
1013759787 6:113503902-113503924 CTGTGCATGTGTGGGGACAGGGG + Intergenic
1014107339 6:117582263-117582285 GTGTGTGTGTGTAGGGGGGGAGG - Intronic
1014141148 6:117944564-117944586 ATGTGTGTGTTTTGGGAGAGGGG - Intronic
1014148934 6:118031031-118031053 CTGTGCCTGTGTGGGGAGAGGGG - Intronic
1014660525 6:124165663-124165685 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1015201330 6:130584722-130584744 CTGTGGGTCAGAAGAGAGAGAGG - Intergenic
1015525429 6:134171364-134171386 GTGTGTGTGTGGAGGGTGAGGGG + Intronic
1015635896 6:135273722-135273744 CTCTGGCTGTGTAGACAGAGTGG + Intergenic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1016118229 6:140314555-140314577 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
1016294443 6:142559852-142559874 CTGTAGTTGTGTGGGGGGAGGGG - Intergenic
1016539616 6:145149933-145149955 CAGTGGTAGGGTAGGGAGAGGGG + Intergenic
1016778492 6:147932628-147932650 GTGTGTGTGTGTTGGGGGAGGGG + Intergenic
1017839989 6:158213591-158213613 AGGTGGGGGTGCAGGGAGAGGGG + Intergenic
1018097697 6:160406159-160406181 CTGTGCATGTGTAGGGGCAGGGG + Intronic
1018862827 6:167723262-167723284 CTGTGTGTGAGTGTGGAGAGGGG - Intergenic
1018873860 6:167803429-167803451 CTGTGGGCCTGGAGGCAGAGGGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019869617 7:3747707-3747729 GTGTGTGTGTGTATGGTGAGGGG + Intronic
1020050245 7:5076572-5076594 CTGTGGGTGTGTTGGGTTTGGGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020123751 7:5520759-5520781 CTGTGGGTGTCTGGGGACAGCGG + Intergenic
1021280318 7:18708903-18708925 GTGTGGGTGTGTGTGGAGAGAGG - Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021442159 7:20688961-20688983 CTGTGGTGGGGTGGGGAGAGGGG + Intronic
1021487840 7:21186847-21186869 GTGTGTGTGTGTTGGGAGACTGG - Intergenic
1021932373 7:25594568-25594590 CTGAGGGTGTGCAGGGCCAGGGG - Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022190784 7:28015055-28015077 GTGTGTGTGTGTAGGGGTAGGGG + Intronic
1022527468 7:31047892-31047914 GTGTGGGTGTGTTGGGGGTGGGG - Intergenic
1022561560 7:31354857-31354879 CTGAGCATGTGTAGGGAGAGGGG + Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023750891 7:43371382-43371404 CTGTGCGTGTGTGGGGACAGGGG + Intronic
1023773908 7:43584674-43584696 GGGTGGGGGTGTAGGGAGGGTGG + Intronic
1024753224 7:52495054-52495076 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
1024843352 7:53613749-53613771 ATGGGGGTGTGGAGGGAGTGAGG + Intergenic
1024854749 7:53765098-53765120 CTATGCATGTGTAGGGGGAGGGG - Intergenic
1025262245 7:57426861-57426883 GTGTGTGTGTGTAGGGGGGGGGG + Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026312045 7:69194826-69194848 CTATGGGAGGGGAGGGAGAGGGG + Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1028332898 7:89618762-89618784 GTGTGTGTGTGTATGGAGTGGGG - Intergenic
1029435076 7:100559431-100559453 CTGAGGGGGAGTATGGAGAGAGG + Intronic
1029474314 7:100773909-100773931 CTGTTGGGGAGTTGGGAGAGTGG - Intronic
1029491818 7:100874898-100874920 CTCTGGGCGCGAAGGGAGAGCGG - Intergenic
1029638449 7:101802173-101802195 GTGTGTGTGTGTAGAGACAGGGG - Intergenic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1030682848 7:112451032-112451054 CTGAGAGTGTGTCGGGACAGGGG + Intronic
1030812939 7:113997742-113997764 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1031481050 7:122279061-122279083 CTGTGGGTGGGTGGGGGGAGGGG - Intergenic
1031644484 7:124207179-124207201 CTCTGGGTGTGTAAAGAGAGTGG - Intergenic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1032089675 7:128904989-128905011 GTGTGTGTGTGTTGGGGGAGCGG + Intronic
1032123270 7:129172037-129172059 CTGGGGGTGTGTAGGGGTGGGGG + Intergenic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032275042 7:130446970-130446992 GTGTGTGTGTGTATGCAGAGAGG - Intergenic
1032526483 7:132581719-132581741 GTGTGTGTGTGTAGGAGGAGAGG - Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032854917 7:135825965-135825987 ATGTGTGTGTGTTGGGGGAGGGG + Intergenic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033240717 7:139677203-139677225 GTGTGTGTATGTAGAGAGAGAGG + Intronic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034499749 7:151441910-151441932 GTGTGTGTGTGTAGGGGCAGGGG - Intergenic
1034968813 7:155407126-155407148 CTGTGGGAGTGTGGGGTGTGGGG + Intergenic
1034968848 7:155407250-155407272 CTGTGGGAGTGTGGGGTGTGGGG + Intergenic
1034971581 7:155423021-155423043 TTGAGGGTGTGTAGGGCGGGAGG - Intergenic
1035368708 7:158364759-158364781 CTGTGTGTGTGGACAGAGAGAGG - Intronic
1035636248 8:1146679-1146701 ATGTGCCTGTGTAGGGAGAGGGG + Intergenic
1035869700 8:3124132-3124154 CTGTGTGCGTGTGGGGAGGGGGG + Intronic
1035910089 8:3556817-3556839 CTATGGCAGTGAAGGGAGAGGGG - Intronic
1036236449 8:7043314-7043336 GTGTGGGTGTGACAGGAGAGAGG + Intergenic
1036643350 8:10597621-10597643 GTGTGAGTGTGTTGGTAGAGTGG - Intergenic
1037333504 8:17768574-17768596 TTGAGGGTGGGTAGGGAAAGGGG - Intronic
1037338879 8:17820681-17820703 CTGTGTGTGTGTAGAGGGGGAGG - Intergenic
1037510468 8:19576994-19577016 AGGTGGGTGTGGAGGGCGAGAGG - Intronic
1038274947 8:26113609-26113631 CTGTGGGTGGAGATGGAGAGTGG + Intergenic
1038414357 8:27383245-27383267 CTCGGCGTGTGTTGGGAGAGTGG - Intronic
1038516830 8:28194494-28194516 GTGTGTGTGTGTATAGAGAGAGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039556659 8:38481266-38481288 CTGTGTGTGTGTTGAGGGAGGGG + Intergenic
1039798432 8:40934593-40934615 CTTAGGATGTGAAGGGAGAGTGG - Intergenic
1039898840 8:41735947-41735969 GGGTGTGTGTGTAGGGAGAGGGG + Intronic
1040454579 8:47583799-47583821 CTGTGGGTGTGTGAAGGGAGAGG - Intronic
1040771197 8:50977889-50977911 TTGTGGGGGTGTGGGGAGGGGGG + Intergenic
1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG + Intergenic
1041193493 8:55376923-55376945 TTGTGTGTGTGTATGGAGAGGGG - Intronic
1042383120 8:68142036-68142058 CTGTACATGTGTAGGGACAGGGG - Intronic
1042917616 8:73890715-73890737 CTGGGGGTTGGTGGGGAGAGTGG + Intergenic
1043694570 8:83203137-83203159 GTGTGTGTGTGTTGGGGGAGCGG - Intergenic
1044050029 8:87489757-87489779 GTGTGTGTGTGTAGATAGAGAGG + Intronic
1044194383 8:89356816-89356838 CTGCAGGTGTTTAGGGAAAGTGG - Intergenic
1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG + Intergenic
1044441607 8:92230776-92230798 AGGGGGGTGTGGAGGGAGAGGGG + Intergenic
1045037230 8:98185036-98185058 GTGTGTGTGTGTTGGGAGTGGGG - Intergenic
1045169578 8:99649615-99649637 GTGTGTGTGTGTATGTAGAGGGG - Intronic
1045317827 8:101058665-101058687 CTGTGGGGCTGCAGAGAGAGGGG - Intergenic
1045368360 8:101496560-101496582 CTGTGTGTGTGTTGGGGGTGGGG + Intronic
1045506512 8:102782411-102782433 CTGGGTGTGTGGAGGGACAGAGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046790235 8:118313901-118313923 GTGTGTGTGTAGAGGGAGAGAGG + Intronic
1046815903 8:118583402-118583424 GTGTGCTTGTGTAGGGAGATGGG + Intronic
1046838865 8:118835169-118835191 GTGTGTGTGTGTTGGGAGGGAGG + Intergenic
1047118670 8:121875145-121875167 CTGTAGGTGTGTTGAGGGAGGGG - Intergenic
1047622167 8:126618883-126618905 CTGAGGGCTTGTAGGGGGAGAGG - Intergenic
1047718650 8:127618919-127618941 CTGTGTGTGTTTGGGGTGAGGGG + Intergenic
1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG + Intergenic
1048028641 8:130610143-130610165 GTGTGTGTGTGTAAAGAGAGGGG - Intergenic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048570783 8:135653987-135654009 CTGTGGGTGTGTGGGGGTAAAGG - Intronic
1048855309 8:138681736-138681758 CAGTGGGTATATATGGAGAGGGG - Intronic
1048885981 8:138910290-138910312 GTGTGGGTGTGTATGTTGAGGGG - Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049353503 8:142176689-142176711 TTATGGGTGTGCAGGGAGTGGGG - Intergenic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049359104 8:142203479-142203501 CAGTGAGTGTGCAGGCAGAGAGG - Intergenic
1049374425 8:142282202-142282224 CTGGGGGGGTGTAGGGAGAGCGG - Intronic
1049487103 8:142871755-142871777 CTTTGGGTGTGTGGTGACAGTGG - Intronic
1049514097 8:143044427-143044449 TTGTGGGTCTGCAGGGACAGGGG - Intronic
1049708962 8:144055213-144055235 CTGTGGGTGGGTGGGGCCAGCGG - Intronic
1049726730 8:144150011-144150033 CTGGGTGTGTGCAGGGAGACTGG - Intronic
1049865492 8:144932900-144932922 GTGTGGGTGTCGAGGAAGAGGGG - Intronic
1050206606 9:3202922-3202944 GTGTGTGTGTGTAGGGGGTGGGG + Intergenic
1050615959 9:7402054-7402076 GTGTGTGTGTGTTGGGAAAGGGG - Intergenic
1050882552 9:10721002-10721024 CTGTTGTGGGGTAGGGAGAGAGG + Intergenic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051567532 9:18517565-18517587 CTGTGGTGGTGTGGGGGGAGGGG - Intronic
1051839020 9:21373524-21373546 CTGTTGGTGGGTGGGGGGAGGGG - Intergenic
1052816691 9:33107421-33107443 GTGTGGGGGTGGGGGGAGAGGGG - Intronic
1052840434 9:33288377-33288399 GTGTGGGTGTGTGTGGAGTGTGG + Intergenic
1052864692 9:33457832-33457854 GTGGGGTTGTGCAGGGAGAGAGG - Intergenic
1053103708 9:35392636-35392658 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1053229763 9:36397964-36397986 CCGTGTGTGTGTTTGGAGAGAGG - Intronic
1053749164 9:41235639-41235661 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054254601 9:62800492-62800514 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054336702 9:63815110-63815132 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1055375887 9:75648091-75648113 CTGTGGGTGTGTGATGGGAGGGG + Intergenic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1056039529 9:82648335-82648357 GTCTGTGTGTGTAGAGAGAGAGG + Intergenic
1056336850 9:85579589-85579611 GTGTGTGTGTGTGGGGCGAGGGG + Intronic
1056555941 9:87687275-87687297 CTGTGTGTGTGTGTGGAGAGGGG - Intronic
1056677281 9:88686291-88686313 GGGTAGGTGTGGAGGGAGAGGGG - Intergenic
1056761873 9:89421169-89421191 CTGTGGCTGTGGACGGGGAGAGG + Intronic
1056803705 9:89712013-89712035 GTGTGGGTGTGTAGTGTGTGTGG - Intergenic
1056844891 9:90029118-90029140 CTGTGGATGTGTGGGGGCAGAGG + Intergenic
1056914326 9:90731613-90731635 CTGTGTGTGTGTGTGGGGAGGGG + Intergenic
1057416010 9:94862757-94862779 GGGTGGATGTGTTGGGAGAGAGG + Intronic
1057437330 9:95053885-95053907 TTGGGGGTGGGTAGGGAGCGAGG + Intronic
1058151878 9:101472670-101472692 CAGTGTGTGTGTTGGGAGTGGGG + Intergenic
1058275649 9:103038190-103038212 CTGTGGGTGTTGGGGGACAGGGG - Intergenic
1059165408 9:112072517-112072539 TTCTGTGTGTGTTGGGAGAGGGG - Intronic
1059311508 9:113391624-113391646 CTGTGTGGGTGTGGGTAGAGGGG + Intronic
1059547807 9:115196403-115196425 GTTTGGGGGTGTAGAGAGAGGGG - Intronic
1059704209 9:116805132-116805154 GTGTGTGTGTGTAGGCAGACAGG + Intronic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1059745825 9:117200228-117200250 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1060104650 9:120866097-120866119 CTGTGGGTGGGTAGAGACGGGGG + Intronic
1060367883 9:123037729-123037751 GTGTGTATGTGTTGGGAGAGAGG + Intronic
1060428946 9:123531544-123531566 GTGTGTGTGTGTAGAGAGAGAGG - Intronic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1060937287 9:127522841-127522863 GTGTGTGTGTGTTGGGGGAGGGG - Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061330318 9:129888430-129888452 CTGTTGGTTTGCAGGGACAGAGG + Exonic
1061498365 9:130988842-130988864 GTGTGTGTGTGTTGGGGGAGGGG - Intergenic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1062086946 9:134653895-134653917 CTGAGGGTGTGTAGGGCTGGGGG + Intronic
1062087002 9:134654132-134654154 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087032 9:134654259-134654281 CTGTAGGTGTGTAGGGCTGGAGG + Intronic
1062087115 9:134654607-134654629 CTGAGGGTGTGTAGGGCTGGGGG + Intronic
1062087119 9:134654623-134654645 CTGGGGGTGTGTAGGGCTGGAGG + Intronic
1062087173 9:134654874-134654896 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087188 9:134654921-134654943 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087226 9:134655062-134655084 CTGGAGGTGTGTAGGGCTAGGGG + Intronic
1062235721 9:135506658-135506680 CCCTGGGTGTGTGGGGGGAGGGG + Intergenic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1203569956 Un_KI270744v1:121149-121171 GTGTGGGCGTGTTTGGAGAGTGG + Intergenic
1185579623 X:1201346-1201368 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1185798422 X:2986834-2986856 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1185872437 X:3675094-3675116 ATGTGGGTGTGTGGGGCGTGTGG - Intronic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186722817 X:12323700-12323722 CTTTGGGTGTCTAAGGTGAGGGG + Intronic
1187474823 X:19601639-19601661 CTGTGGGTGAGGCTGGAGAGGGG + Intronic
1187496458 X:19799830-19799852 GTGTGAGTGTGTAGTGGGAGGGG - Intronic
1187528120 X:20072244-20072266 CTGTGTGTGTGTTGGGGGTGGGG - Intronic
1187759037 X:22559371-22559393 CTGTGGGGGTATAGTGTGAGTGG + Intergenic
1188097202 X:26039280-26039302 CTGTTGGTGTCTGGGGAGAGTGG - Intergenic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189882919 X:45510766-45510788 CTGTGTGTGGGTAGGGGGATAGG - Intergenic
1190037243 X:47036953-47036975 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1190470239 X:50771193-50771215 CTTTGTGTGTGAAGGGAGGGTGG - Intronic
1191671402 X:63751866-63751888 ATGTGTGTGTGTAGGGTGTGTGG - Intronic
1191757570 X:64610365-64610387 CTGTTGTGGGGTAGGGAGAGGGG - Intergenic
1192100151 X:68255714-68255736 GTGTGTGTGTGTATGTAGAGCGG - Intronic
1192453310 X:71257076-71257098 CTGTGTCTGTGTGTGGAGAGGGG + Intergenic
1192556109 X:72090797-72090819 GTGTGTGTGTGTATGGAGAGGGG + Intergenic
1193057435 X:77168499-77168521 CTGTGGGTGTTTGGGGGTAGGGG + Intergenic
1193089260 X:77476607-77476629 CTGTTGTTGGGTAGGGGGAGGGG + Intergenic
1193210593 X:78802522-78802544 CTGTTGTTGGGTAGGGGGAGGGG - Intergenic
1193738650 X:85190963-85190985 CTGTCGTGGTGTAGGGGGAGGGG + Intergenic
1193773851 X:85619953-85619975 CTGTTGATGTGTAGGGGGTGGGG - Intergenic
1194661681 X:96634671-96634693 CTGTGGGTGTGTAGGTGTAGGGG + Intergenic
1194669509 X:96713404-96713426 CTGTGGGTGTGTGGGAATAGAGG - Intronic
1194933940 X:99924501-99924523 GTGTGTGTGTGTTGGGAGAGGGG - Intergenic
1195008874 X:100715747-100715769 CTGTGTGTGTGTAGAGAGATGGG - Intronic
1195269045 X:103213019-103213041 GTGTGTGTGTGTATGGAGATGGG + Intergenic
1195975573 X:110522477-110522499 CTGCGTGTGTGCAGGGAGACTGG + Intergenic
1196051833 X:111313858-111313880 CTGAGGGTGTGTGGAGAGTGGGG + Intronic
1196128432 X:112125420-112125442 CTGCGGTTTTGTGGGGAGAGTGG - Intergenic
1196298211 X:114023588-114023610 CTGTGTGTGTGTTGGTAGGGGGG + Intergenic
1196801673 X:119549213-119549235 CTTTGTGTGTGTAGGTAGTGAGG - Intronic
1197659686 X:129156755-129156777 CTGTTGTGGGGTAGGGAGAGGGG - Intergenic
1197723458 X:129760392-129760414 CTGGGTGTGTGTAGGCAGGGTGG - Intronic
1197783140 X:130176274-130176296 GTGTGTGTGTGTAGAGAGGGAGG + Intronic
1197901140 X:131373674-131373696 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1197901142 X:131373676-131373698 GTGTGTGTGTGGAGAGAGAGGGG + Intronic
1198800491 X:140443247-140443269 CTGTGGTGGTGTGGGGAAAGGGG - Intergenic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199808531 X:151326671-151326693 GTGTGTGTGTGTAGTTAGAGTGG - Intergenic
1199895649 X:152125121-152125143 CTGTGCATGTGCATGGAGAGAGG - Intergenic
1200016946 X:153172186-153172208 CTGTGCATGTGCATGGAGAGGGG + Intergenic
1200784672 Y:7249703-7249725 CTGTGGTGGTGTTGGGAGAGGGG - Intergenic
1201065426 Y:10091021-10091043 CTCTGGGTGTGTGGGGTAAGAGG - Intergenic
1201073418 Y:10169952-10169974 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1201079392 Y:10221594-10221616 CTGTGGTGGGGTCGGGAGAGGGG + Intergenic
1201229800 Y:11853145-11853167 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
1201254586 Y:12094204-12094226 CTGTTGTGGTGTGGGGAGAGGGG + Intergenic
1201360586 Y:13143892-13143914 GTGTGTGTGTGACGGGAGAGGGG + Intergenic
1202165605 Y:21984353-21984375 CTGTTGTTGGGTGGGGAGAGAGG - Intergenic
1202225753 Y:22602019-22602041 CTGTTGTTGGGTGGGGAGAGAGG + Intergenic
1202317360 Y:23593642-23593664 CTGTTGTTGGGTGGGGAGAGAGG - Intergenic
1202348138 Y:23957019-23957041 CTGTGGTGGTGTCGGGGGAGGGG - Intergenic
1202349710 Y:23975075-23975097 CTGTGCATGTGTAGGGGCAGTGG - Intergenic
1202521069 Y:25695045-25695067 CTGTGCATGTGTAGGGGCAGTGG + Intergenic
1202522636 Y:25713085-25713107 CTGTGGTGGTGTCGGGGGAGGGG + Intergenic
1202553405 Y:26076416-26076438 CTGTTGTTGGGTGGGGAGAGAGG + Intergenic