ID: 1021312216

View in Genome Browser
Species Human (GRCh38)
Location 7:19108925-19108947
Sequence TGATACCAAGAGCAGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021312216_1021312221 23 Left 1021312216 7:19108925-19108947 CCACCAAACTGCTCTTGGTATCA 0: 1
1: 0
2: 2
3: 20
4: 170
Right 1021312221 7:19108971-19108993 TATACTCTTGATTTAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021312216_1021312218 -9 Left 1021312216 7:19108925-19108947 CCACCAAACTGCTCTTGGTATCA 0: 1
1: 0
2: 2
3: 20
4: 170
Right 1021312218 7:19108939-19108961 TTGGTATCATTATCCCGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021312216 Original CRISPR TGATACCAAGAGCAGTTTGG TGG (reversed) Intronic
901207809 1:7507439-7507461 TGAGGCCAAGAGCTGCTTGGGGG - Intronic
905563784 1:38947366-38947388 AATGACCAAGAGCAGTTTGGAGG - Intergenic
907270862 1:53290262-53290284 AGATCCCCAGAGCAGTGTGGAGG - Intronic
910644383 1:89497629-89497651 TGCTACAAAGAACAGTTTGGAGG + Intergenic
910852788 1:91665210-91665232 TGATACCAGGAGCAAGGTGGTGG + Intergenic
915202188 1:154239311-154239333 TCATACCAGGAGCAGTCTGGGGG - Intronic
916766634 1:167867106-167867128 TGATACCAGGAGCAAGGTGGCGG - Intronic
917834094 1:178927262-178927284 TGATTCCAAGAGCAGCTAGTAGG - Intergenic
917950719 1:180031450-180031472 TGATACAGATAGCACTTTGGAGG + Exonic
918645619 1:186901108-186901130 TGAGACAAAGTGGAGTTTGGAGG + Intronic
923534068 1:234834946-234834968 TGATTCCAACAGCAGGTTGAAGG + Intergenic
1065931197 10:30480451-30480473 TGATACCAGGAGCAAGGTGGTGG - Intergenic
1066220329 10:33331616-33331638 TGATACCCAGACCTGTGTGGTGG - Intronic
1067517858 10:46969080-46969102 AGATACCAAAAGAAGTTTTGTGG - Intronic
1067644390 10:48082749-48082771 AGATACCAAAAGAAGTTTTGTGG + Intergenic
1069276725 10:66600637-66600659 TGATACCAAGAGAGATTTTGGGG - Intronic
1070265153 10:74894968-74894990 TGCTATAAAGAACAGTTTGGCGG - Intronic
1071747339 10:88437010-88437032 TGATGCTTACAGCAGTTTGGGGG + Intronic
1072505225 10:96059484-96059506 TTACAGCAAGGGCAGTTTGGGGG + Exonic
1072941659 10:99769762-99769784 AGATACCAGGAGAAGTTTGCTGG + Intergenic
1079311210 11:19367594-19367616 TGACTCCAAGAGCAGATGGGTGG - Intronic
1080287458 11:30631962-30631984 TGATACCAAGTGGAGTCTGTTGG + Intergenic
1080775430 11:35381698-35381720 GGCAAACAAGAGCAGTTTGGGGG - Intronic
1080836734 11:35946398-35946420 ACATTCCAAGAGCAGTTTGGAGG + Intronic
1084847407 11:71911320-71911342 TGATACCAGGAGCAAGGTGGCGG - Intronic
1084912964 11:72406140-72406162 GGATAAGAAGACCAGTTTGGAGG + Intronic
1085998915 11:81955194-81955216 TGATACCAGGAGCAAGGTGGCGG - Intergenic
1086308901 11:85513716-85513738 TGACAGCAAGACCAGTCTGGTGG - Intronic
1091226246 11:133957830-133957852 TGAAACCAAGATGGGTTTGGGGG + Intergenic
1091501650 12:1023462-1023484 TGATACGGAGTTCAGTTTGGGGG + Intronic
1092163121 12:6327142-6327164 TGATACCAAAATAAGTTTGGAGG + Intronic
1096613858 12:52820547-52820569 TGATACCAAGAGACGCATGGAGG + Intergenic
1100332441 12:93597126-93597148 TTATACCAAGATCAGTTTTCTGG - Intergenic
1100487092 12:95040517-95040539 TGATAAGAACAGCAGTCTGGAGG + Exonic
1105555531 13:21444715-21444737 ACCTATCAAGAGCAGTTTGGAGG - Intronic
1111821879 13:93225217-93225239 TGATACAAAGAGAAGTTTGAAGG + Intergenic
1111889576 13:94064857-94064879 AGATACCAAGAGTACTTGGGAGG - Intronic
1114026479 14:18531761-18531783 AGAATCCAACAGCAGTTTGGTGG - Intergenic
1114681095 14:24483889-24483911 GGATGTCAAGAGCAGTGTGGAGG - Intergenic
1115290876 14:31770760-31770782 AAAGACCAAGGGCAGTTTGGAGG + Intronic
1115788160 14:36849277-36849299 TGATACGAAGAGGACTTTGGGGG + Intronic
1117169063 14:53071949-53071971 TGATGCCAAGAGAGGTTTTGAGG - Intronic
1118578380 14:67267777-67267799 TATTACAAAAAGCAGTTTGGTGG - Intronic
1119282573 14:73422399-73422421 TGAAAACAAGGGCAATTTGGAGG - Intronic
1120566107 14:86059594-86059616 TAAAACCAAGAGCAGTCTGGGGG - Intergenic
1120909293 14:89651184-89651206 TGAGTCCAAAAGCAGTCTGGAGG - Intergenic
1121358461 14:93233913-93233935 TGTTTGGAAGAGCAGTTTGGCGG - Intergenic
1121749948 14:96343678-96343700 TGTTACCAAGAGATGTTTTGTGG - Intronic
1126814699 15:52443091-52443113 TGATACCAAGAACAATTTGGGGG - Intronic
1126825936 15:52547994-52548016 TGATAACTAAAGCAGTTTGGTGG - Exonic
1127222413 15:56893566-56893588 AGGTACCAACAGAAGTTTGGAGG - Intronic
1128227663 15:66013386-66013408 TAATATCAAGAGCAGTTGTGGGG - Intronic
1133675608 16:8068670-8068692 TGCTATGAAGAACAGTTTGGAGG - Intergenic
1134382134 16:13737695-13737717 TGTTAGCAAGAGCAGTTTCATGG - Intergenic
1137032168 16:35533318-35533340 GGATGCCAACAGCATTTTGGGGG - Intergenic
1139220536 16:65177122-65177144 TGACACCAAGAGCAAGTTTGTGG + Intergenic
1140037595 16:71383059-71383081 TGATAGCCAGAGGAATTTGGAGG - Intronic
1143053843 17:4148024-4148046 TGGTATGAAGAGCAGATTGGTGG + Intronic
1143287242 17:5799490-5799512 TGACCCCAAGAGAAGTTTGTGGG + Intronic
1147026306 17:37587684-37587706 CGTTACCAAGAGCAGTTTGGGGG - Intronic
1147810136 17:43162956-43162978 TGATACCAGGAGCAAGGTGGTGG + Intergenic
1151504955 17:74521642-74521664 TAGAACCAAGAGCAGGTTGGAGG + Exonic
1151909379 17:77071771-77071793 AGATTTCAAGAGCAATTTGGTGG + Intergenic
1154013972 18:10600138-10600160 TGATACCAGGAGCAAGGTGGTGG + Intergenic
1156475825 18:37404727-37404749 TGTGACCAAGACCAGTGTGGAGG + Intronic
1160459772 18:79029762-79029784 AGAAACAAAGAGCAGATTGGTGG - Intergenic
1163916740 19:20246741-20246763 TGATACCGGGAGCAGGGTGGTGG - Intergenic
1165950321 19:39470607-39470629 TGCAACCCAGAGCAGTCTGGGGG - Intronic
1166592709 19:44015015-44015037 TACTACCAAGGGCAGTTTGGTGG + Intergenic
1167942559 19:52959328-52959350 TGATACCAAGAGTAAGGTGGCGG - Intronic
925187030 2:1855053-1855075 GGATACCAAGAGCGGTTGGAAGG - Intronic
925857867 2:8148097-8148119 TGAGTCCAAAAGCAGTCTGGAGG + Intergenic
926612139 2:14957481-14957503 TGACACAAAGATCAGTTTGAGGG + Intergenic
930243611 2:48961099-48961121 TGATCCCAAAAGCATTTTGGAGG - Intergenic
930832944 2:55764648-55764670 GGCTACCAAGAGAAGTTTTGTGG - Intergenic
931910742 2:66897174-66897196 TGATAACAAAAGCATTCTGGAGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934670535 2:96209504-96209526 TGATCTTAAGAGCAGTTTAGGGG - Intergenic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
937667421 2:124502756-124502778 AGATACCAAGAGCAAGTTGGTGG + Intronic
940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG + Intronic
940743030 2:157533965-157533987 TAATACGAAGAGCAGTTAGGCGG + Exonic
940872146 2:158869017-158869039 TGATACCAGGAGCAAGGTGGCGG - Intergenic
942586336 2:177483084-177483106 TGATATCCAGAGCAGTGTGGAGG + Intronic
943187147 2:184625035-184625057 TGATACCAAGAGTACCTTGTAGG - Intronic
945186210 2:207142461-207142483 TGATACCATGAGCACCTTGTAGG - Intronic
945289920 2:208116758-208116780 TGATACCAGGAGCAAGGTGGTGG - Intergenic
947434929 2:230065144-230065166 AAATATCAAGAGCAGTTTGTTGG - Intronic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
948745480 2:240089718-240089740 TGATGGCAAGAGCAGGTTTGGGG + Intergenic
1169406454 20:5325150-5325172 TGATGCCAAGAGCATTCTGTGGG - Intergenic
1169909366 20:10634901-10634923 TAAAACTAAGAGCAGGTTGGGGG - Intronic
1170922287 20:20690517-20690539 TGATGCCCAGAGCTGTGTGGGGG - Intronic
1172024530 20:31938922-31938944 TGTTACCAAGAGCAAGTAGGAGG + Intronic
1172603635 20:36200332-36200354 TGATCCCAAAATCAGTTTTGTGG + Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173280148 20:41619703-41619725 TGATTCTAAGAGCAGTTTGTGGG + Intergenic
1173426038 20:42944322-42944344 GGATAGGAAGAGCAGTTTGCAGG - Intronic
1175513721 20:59554331-59554353 TGATACCAGGAGCAAGGTGGTGG + Intergenic
1175718694 20:61272639-61272661 GGATACCATGGGCAGTTTGAGGG + Intronic
1178000607 21:28158483-28158505 TGAAATCAAGAGAAGTTTAGGGG - Intergenic
1179520142 21:41937913-41937935 AGAAACCAAGAGCAGAATGGTGG + Intronic
1179669229 21:42934012-42934034 TGATACCAGGAGCAAGGTGGCGG - Intergenic
1180450613 22:15458957-15458979 AGAATCCAACAGCAGTTTGGTGG - Intergenic
951244174 3:20321136-20321158 TGATACCAAGAAATGTTTTGTGG - Intergenic
952442622 3:33347590-33347612 TGTTATGAAGAACAGTTTGGAGG - Intronic
952801686 3:37298470-37298492 TGATATTAGGAGCAGTTTAGTGG + Intronic
953522143 3:43653903-43653925 AGATGCAAAGAGCAGTTTGCTGG + Intronic
955580335 3:60412828-60412850 TGATCACAAGAGCAGCATGGGGG - Intronic
955686984 3:61558980-61559002 TGCTTCCAAGGGTAGTTTGGGGG + Intergenic
955985943 3:64574299-64574321 TAATTCCAACAGCAGTCTGGTGG + Intronic
957874494 3:86128355-86128377 TGCTACCATGAGAAGTTTGAAGG + Intergenic
957907137 3:86571634-86571656 TGCTATGAAGAACAGTTTGGAGG - Intergenic
958140409 3:89555563-89555585 TTATACAAAGAGGAGTTTTGAGG - Intergenic
958664768 3:97122559-97122581 TGATACCAAGAGAACTTTATTGG - Intronic
959204084 3:103283094-103283116 TTATACAAAGAGAATTTTGGAGG - Intergenic
961141686 3:124561728-124561750 TCACCCCAAAAGCAGTTTGGAGG - Intronic
962586486 3:136847405-136847427 TGCAACCAAGAGAATTTTGGTGG + Intronic
963791166 3:149583826-149583848 TGAAACAACGAGCAGTATGGTGG + Intronic
964337498 3:155671571-155671593 TTATACTAAGAGAAGTTAGGAGG + Intronic
964710622 3:159667846-159667868 TGAGACTAAGAACTGTTTGGTGG - Intronic
969019689 4:4131558-4131580 TGATACCAGGAGCAAGGTGGCGG + Intergenic
972830155 4:42805637-42805659 TGATATCAACAGTAGTTTGTTGG - Intergenic
973533721 4:51859538-51859560 TCTTACCTAGAGTAGTTTGGGGG + Intronic
975793563 4:77983633-77983655 TGATGACAAGGGCAGTTTTGTGG - Intergenic
977004528 4:91548286-91548308 TGATACAAGGGACAGTTTGGAGG - Intronic
978171333 4:105673742-105673764 AGATACTAATAGCAGTTGGGTGG + Intronic
978232433 4:106416315-106416337 TGAGTCCAAAAGCAGTTTGGAGG + Intergenic
980073170 4:128264898-128264920 TGATACCAGGAGCAAGGTGGCGG - Intergenic
986726506 5:10601938-10601960 TGAGAACAAGACCAGTTAGGGGG + Intronic
989095870 5:37780834-37780856 TGATACCAGGAGCAAGGTGGCGG + Intergenic
989117008 5:37964825-37964847 TGATACCCAGTGCAGTATTGGGG + Intergenic
991258502 5:64641694-64641716 AGATACTAAGAGCTGATTGGAGG + Intergenic
996931169 5:128890115-128890137 TGCTACAGAGAACAGTTTGGAGG - Intronic
996944051 5:129045224-129045246 TGATATCAATAGCATTTTTGGGG + Intergenic
997715080 5:136036570-136036592 TGAGACCAAGACCAGTGAGGAGG + Intronic
999855658 5:155590578-155590600 TAGTACTAATAGCAGTTTGGGGG + Intergenic
1002665096 5:180817277-180817299 TGACACAAAGACCGGTTTGGAGG + Intergenic
1004481779 6:16026348-16026370 GGATACCTAGAGCATTTTTGGGG + Intergenic
1008935281 6:56985347-56985369 TAATAGTAAGAGCAGTTTAGGGG + Intronic
1011256893 6:85431784-85431806 AATGACCAAGAGCAGTTTGGAGG - Intergenic
1014046615 6:116896027-116896049 TGATAAAAAGAGCAATCTGGAGG - Intronic
1014138808 6:117917845-117917867 GGGTACCAAGAACAATTTGGGGG + Intronic
1014260073 6:119206289-119206311 GGACACCAAGAGCATTTTGATGG - Intronic
1014339760 6:120189999-120190021 TGAATCCAAAAGCAGTCTGGAGG + Intergenic
1015095660 6:129412219-129412241 TGAATCCAAAGGCAGTTTGGAGG + Intronic
1015172093 6:130265180-130265202 TGATACCAGGAGCAAGGTGGCGG - Intronic
1016203453 6:141442196-141442218 TAATACCAATAGCAGTGTGGTGG - Intergenic
1016369796 6:143361760-143361782 TGATACCATGAGCAGTGTAGAGG - Intergenic
1017160589 6:151361979-151362001 TGAGATCAAGAGCTGTTAGGAGG + Intergenic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1024145359 7:46511230-46511252 TGAAACCAGGAGAAGTTTGATGG + Intergenic
1025112184 7:56227380-56227402 TTACAGCAAGGGCAGTTTGGGGG - Intergenic
1028938032 7:96487530-96487552 TAATACAAAGGGCAGTTTGGAGG + Intronic
1028963011 7:96770862-96770884 TGATTTCAAGAGCTGTCTGGCGG + Intergenic
1032170723 7:129582478-129582500 TGATACCAGGAGCAAAGTGGTGG - Intergenic
1033516439 7:142111291-142111313 TTATACCAAGAGAACTCTGGAGG + Intergenic
1036763482 8:11529528-11529550 TGATCTTAGGAGCAGTTTGGGGG + Intronic
1037371560 8:18184439-18184461 TGATCCCAAAGGCATTTTGGAGG - Intronic
1037906801 8:22720263-22720285 AGATGCCAACAGCAGGTTGGGGG + Intronic
1039278334 8:35955922-35955944 TGATACCAGGAGCAAGGTGGTGG - Intergenic
1039730472 8:40270229-40270251 AATGACCAAGAGCAGTTTGGGGG + Intergenic
1040992613 8:53368831-53368853 TGATACCAGGAGCAAAGTGGTGG + Intergenic
1041515636 8:58696087-58696109 TGATACCAGGAGCAAGGTGGCGG - Intergenic
1042342122 8:67691425-67691447 TGATTTCAAGGGCAGTTTTGGGG - Intronic
1042827314 8:72992010-72992032 TGATCCCAAGATCAGTATTGGGG - Intergenic
1051143484 9:14003134-14003156 TGACACCAGCAGCAGTGTGGGGG - Intergenic
1052508267 9:29382125-29382147 TGATACCAGGAGCAAGGTGGTGG - Intergenic
1053301262 9:36951435-36951457 TGATAACAAGAACAATTTGTAGG - Intronic
1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG + Exonic
1058999477 9:110333448-110333470 TGACACCAGGACCAGTTTTGTGG - Intronic
1060167119 9:121426935-121426957 TGATGCCAAAAGCAGTTTTTTGG - Intergenic
1186280816 X:7990903-7990925 TGCTTCCAATAACAGTTTGGGGG - Intergenic
1186784776 X:12947197-12947219 TCATAAAAGGAGCAGTTTGGAGG + Intergenic
1186991553 X:15074695-15074717 GGAAACCAAAACCAGTTTGGGGG + Intergenic
1188180780 X:27052869-27052891 TGTGACCAAGAGCAGATTGGTGG - Intergenic
1188475667 X:30588950-30588972 TGTTACGAAGAGCAGTTTAGAGG - Intergenic
1188686593 X:33077117-33077139 TGATCTTAGGAGCAGTTTGGTGG + Intronic
1188687376 X:33084657-33084679 TGATCTTAGGAGCAGTTTGGTGG + Intronic
1189419316 X:40842500-40842522 AGTGACCAAGGGCAGTTTGGAGG - Intergenic
1190314817 X:49143847-49143869 TGATACCAGGAGCAAGGTGGCGG + Intergenic
1190425889 X:50334302-50334324 TGATACTAGGAGCAGGGTGGCGG + Intronic
1192113369 X:68388050-68388072 GGAAACAAAAAGCAGTTTGGTGG + Intronic
1194514677 X:94837402-94837424 TACTACCAAAAGCAGTTTAGAGG - Intergenic
1194609220 X:96020173-96020195 AGAAACAAAGAGTAGTTTGGTGG + Intergenic
1194757555 X:97755243-97755265 TGATACCAAGAGCAGGAATGAGG - Intergenic
1194758237 X:97763095-97763117 AGTGACCAAGGGCAGTTTGGAGG + Intergenic
1196869581 X:120099990-120100012 TGATACCAGGAGCAAGGTGGCGG - Intergenic
1198443495 X:136688082-136688104 AGATAGCAAGAGAATTTTGGGGG + Intronic
1199390214 X:147269976-147269998 TGATTCCAAGGGCCGTTTGACGG - Intergenic
1199707230 X:150438916-150438938 TGCTATCAAAAACAGTTTGGCGG - Intronic
1200000680 X:153058344-153058366 CTTTACCAAGAGCAGGTTGGAGG - Exonic
1201373024 Y:13285936-13285958 TGATACCAGGAGCAAGGTGGCGG - Intronic