ID: 1021312953

View in Genome Browser
Species Human (GRCh38)
Location 7:19116077-19116099
Sequence CAGTCTAGAGACTCTGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021312953_1021312961 29 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312961 7:19116129-19116151 CATCTGCAAAAACCCAGAGGGGG 0: 1
1: 0
2: 3
3: 59
4: 381
1021312953_1021312960 28 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312960 7:19116128-19116150 ACATCTGCAAAAACCCAGAGGGG 0: 1
1: 0
2: 1
3: 35
4: 214
1021312953_1021312955 -3 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312955 7:19116097-19116119 CTGTCCATTTTCTCCTTCTCTGG 0: 1
1: 0
2: 4
3: 47
4: 400
1021312953_1021312959 27 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312959 7:19116127-19116149 GACATCTGCAAAAACCCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 361
1021312953_1021312958 26 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312958 7:19116126-19116148 TGACATCTGCAAAAACCCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 235
1021312953_1021312962 30 Left 1021312953 7:19116077-19116099 CCAGCTCCAGAGTCTCTAGACTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1021312962 7:19116130-19116152 ATCTGCAAAAACCCAGAGGGGGG 0: 1
1: 0
2: 3
3: 23
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021312953 Original CRISPR CAGTCTAGAGACTCTGGAGC TGG (reversed) Exonic
901030348 1:6303890-6303912 CATTCTATAGAGTCTGAAGCAGG + Intronic
901913782 1:12481775-12481797 CACTCTAGTGACTCTGCAGCTGG + Intronic
902367164 1:15983734-15983756 TAGGCTGGAGACTCTGGAGATGG - Intergenic
906843487 1:49164946-49164968 GAGTAGAGAGACTATGGAGCTGG - Intronic
908539452 1:65108948-65108970 AAGACTTGAGACTCTGGAGATGG - Intergenic
912391911 1:109308794-109308816 CAACCTAGTGACTCTGGCGCAGG + Intergenic
914769028 1:150667127-150667149 CAGTCTTGAGATTCAGGAGTTGG - Intronic
914801688 1:150967038-150967060 AAATCTAGAGACCCTGGTGCAGG - Intronic
916689374 1:167175945-167175967 CAGTTTACAGACTCTGCAGCTGG - Intergenic
920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG + Intergenic
920878070 1:209855705-209855727 CAGTCTTGGGCCTCTGCAGCTGG + Exonic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923454065 1:234147840-234147862 CACTCAAGAGACTCTGGGGGTGG - Intronic
1062785465 10:261087-261109 CAGTCTAGAGAGTCACGGGCAGG - Intergenic
1063299769 10:4841041-4841063 CCTTCTAGAGACTCTCCAGCTGG - Intronic
1065957472 10:30706081-30706103 CAGTCACCAGACTGTGGAGCAGG + Intergenic
1066465081 10:35643150-35643172 CAGGCTGGAAACTCTGGGGCTGG + Intergenic
1066656908 10:37705017-37705039 CAGCTTAGAGGCTCTAGAGCAGG - Intergenic
1069118441 10:64537025-64537047 CAGAATATAGACTCTTGAGCTGG + Intergenic
1075466135 10:122651482-122651504 CACTCTAGAGCCTCTGGACAAGG + Intergenic
1076686401 10:132200211-132200233 CAGTCTAGAGTCCCTGGCCCTGG - Intronic
1078434783 11:11315490-11315512 CAGCCCAGAGACTCTGGAGTGGG + Intronic
1078850616 11:15159644-15159666 CAGTCTAGACACTGATGAGCTGG + Intronic
1079882517 11:25944667-25944689 CAGTCTGGAAGCTCTGGGGCGGG - Intergenic
1080464708 11:32485956-32485978 CAGTCTGGAGACACTGGAGACGG + Intergenic
1083155914 11:60822694-60822716 CAGGCTTGAGCCACTGGAGCTGG - Intergenic
1084594362 11:70108165-70108187 CAGTGTTGAGAATCCGGAGCTGG + Intronic
1085461931 11:76699360-76699382 TAGTGCACAGACTCTGGAGCTGG - Intergenic
1086907537 11:92434567-92434589 CAGTCTAGCAACTTTGGTGCTGG + Intronic
1088990185 11:114947028-114947050 GAGTCCAGAAACTCTGGAGAAGG - Intergenic
1090309833 11:125725741-125725763 CAGTCTACATACTGTGAAGCAGG - Intergenic
1090639955 11:128721791-128721813 CCTTCTAGAGAGCCTGGAGCGGG - Intronic
1090852652 11:130584122-130584144 GAGTCTAGATCCACTGGAGCAGG - Intergenic
1090930092 11:131289893-131289915 CCATCTATATACTCTGGAGCTGG + Intergenic
1091450551 12:569907-569929 CCGTGTGGACACTCTGGAGCAGG - Intronic
1093361753 12:18237784-18237806 CAGTCTTCAGACTCTGGTGGAGG + Intronic
1096119712 12:49080304-49080326 CAGTGTAGAGAAATTGGAGCAGG - Intergenic
1097978839 12:65716216-65716238 GAGTTTAGAGGCACTGGAGCTGG - Intergenic
1098420950 12:70297334-70297356 CAGACTACAAACTCTGTAGCTGG + Intronic
1100466085 12:94846956-94846978 CAGTCTAGTGTCTCTGGAAGTGG - Intergenic
1102060150 12:109925650-109925672 CAGCCTAGAGGCCCTCGAGCAGG - Intronic
1102162286 12:110779265-110779287 CAATCTTGAGACTCTAGAGGAGG + Intergenic
1106257799 13:28037711-28037733 CAGTCTAGAGGCTGGGGGGCTGG - Intronic
1106335269 13:28777967-28777989 CAGTCTGGAGGCTCAGGAGAAGG + Intergenic
1106391460 13:29339030-29339052 CAGTCTGGAGGCTCAGGAGAAGG + Intronic
1111529584 13:89519309-89519331 CATTCTAGAGACTCTGAAACTGG - Intergenic
1111705764 13:91747540-91747562 CAGTCTAAAATGTCTGGAGCAGG - Intronic
1112034614 13:95485563-95485585 CATTCTAGGGAATCTGGAGTGGG - Intronic
1112890505 13:104224351-104224373 CAGTCTAGAGACTCTGATACAGG - Intergenic
1118256974 14:64214006-64214028 CAGTTTAGACAATCTGGAGTGGG - Intronic
1118259490 14:64234244-64234266 AAGTCTAGAGGCTGTGGAGAAGG - Intronic
1121708589 14:96019938-96019960 CAGTCAATAGACTCTGGGGATGG + Intergenic
1127063709 15:55215192-55215214 GAGGCTGGAGACTCTGGAGTTGG - Intronic
1128300040 15:66560936-66560958 CAGGCTAGAGCCCCTGGGGCAGG + Intronic
1128951083 15:71882720-71882742 AAGACTATGGACTCTGGAGCAGG + Intronic
1130763977 15:86851632-86851654 CACTCTAGAGACTCTGAGGATGG - Intronic
1137519222 16:49177944-49177966 CATTCTGGAGACTCTGGGGCTGG + Intergenic
1140280631 16:73551600-73551622 CAGTCTGGAACCTCTAGAGCTGG + Intergenic
1141061524 16:80876773-80876795 CAGATCATAGACTCTGGAGCCGG - Intergenic
1142112092 16:88338380-88338402 CAGCCTGGAGAGTCAGGAGCCGG - Intergenic
1147315777 17:39619368-39619390 CAGACTAGAGACCCTGGCACGGG - Intergenic
1147680098 17:42237707-42237729 CAGTTTAGAGACTTTGGCCCTGG - Intronic
1148750831 17:49944912-49944934 CAGACCTGAGGCTCTGGAGCCGG - Intergenic
1150132147 17:62675033-62675055 CAGTCCACAGACTCCGCAGCTGG - Intronic
1156247397 18:35314992-35315014 CAGTCTAGAGTCCCTATAGCAGG - Intergenic
1161056279 19:2192048-2192070 CAGCCTAGACACTGTGGAGAAGG - Intronic
1162494930 19:11018299-11018321 CAGCCTAGAGACTGAGGAGAGGG - Intronic
1163002852 19:14379619-14379641 CATTGTAGGGACTCTGGGGCTGG + Intergenic
1167249513 19:48392748-48392770 CAGGGCAGAAACTCTGGAGCAGG - Intergenic
1168544589 19:57240263-57240285 CAGTGCAGAGACCCTGGACCAGG - Intergenic
925371326 2:3347834-3347856 CAGGCTGGAGCCTCTGGATCAGG + Intronic
925808055 2:7672048-7672070 GAGTAGAGATACTCTGGAGCAGG - Intergenic
927438699 2:23093366-23093388 GAGACTAGAGACCCTGAAGCAGG + Intergenic
927998873 2:27506174-27506196 GAGGCTAGAGACCCTGGAGAGGG - Intronic
928041953 2:27887303-27887325 CATTCTGGAGACTCTAGAGGAGG - Intronic
929679380 2:43974746-43974768 CTCTCTATAGACTCTGGAGAAGG - Exonic
929782417 2:44965603-44965625 CAGTCCAGAGACACTGAAACAGG - Intergenic
934638120 2:96009574-96009596 CAGGCTAGAGACCCAGGAGTCGG + Intergenic
934795534 2:97095836-97095858 CGGGCTAGAGACCCAGGAGCCGG - Intergenic
940140154 2:150485089-150485111 CAGACTCGAAACTCTGGAGAAGG - Intronic
940211605 2:151261437-151261459 TAGTCCTGAGCCTCTGGAGCGGG + Intronic
943023448 2:182601776-182601798 CAGAGTAGAGACCCTGGAGTGGG + Intergenic
943511211 2:188830148-188830170 CAGCCTAGGGACTCTGGGCCTGG - Intergenic
944644380 2:201763521-201763543 CTGTCTGGAGACTCTGGTGTGGG - Intronic
945992336 2:216406534-216406556 AAGTCTAAAAACACTGGAGCAGG + Intergenic
946420403 2:219561490-219561512 CAGTCTAGGGACCCTGGGGCTGG - Intronic
946685601 2:222266438-222266460 GGGTCTAGTGACTCTGCAGCTGG - Intronic
1174753287 20:53133384-53133406 AAGTGGAGAGACACTGGAGCTGG - Intronic
1174779010 20:53371274-53371296 CAGTATAGAGACTCTGGCCTAGG + Intronic
1177432066 21:21002559-21002581 CAATCTGAAGACTCTGGAACTGG + Intronic
1181390788 22:22579429-22579451 CAGTTTAGAGAGCCTGGAGGTGG + Intergenic
1184138138 22:42561542-42561564 CTGTGTAGGGACTTTGGAGCTGG + Intronic
949374638 3:3374457-3374479 CAGTCTTCAGATACTGGAGCTGG + Intergenic
950690243 3:14650420-14650442 CCTTCTGGAGACTCTGGAGGAGG + Intergenic
952045924 3:29319951-29319973 CTGTTTTGAGATTCTGGAGCCGG + Intronic
954577290 3:51683618-51683640 AAGTCTAGAGGCTCTGGTGATGG + Intronic
957615755 3:82524534-82524556 AAGTCCAGAGACTGTGTAGCTGG - Intergenic
958728507 3:97935303-97935325 CAGTTTAAAGAATCTGCAGCGGG + Intronic
959354038 3:105303208-105303230 CAGTCTAAAGCCTCAGAAGCAGG + Intergenic
961604454 3:128083389-128083411 CAGTGTAGAGGCACAGGAGCTGG + Intronic
966650873 3:182299593-182299615 CAGAATTCAGACTCTGGAGCTGG + Intergenic
966727775 3:183123141-183123163 TAGTCTAGCGATTCTGGAGCAGG + Exonic
968725327 4:2245297-2245319 CAGTCCCCAGACTCAGGAGCAGG + Intergenic
972564948 4:40261284-40261306 CAGTCTAGAGTCTATATAGCAGG + Intergenic
973258338 4:48135866-48135888 CAGTCTAGAGTCTGTGCACCAGG - Exonic
973580477 4:52339460-52339482 CCTTCTAGACACTCTGGGGCAGG - Intergenic
973876072 4:55220417-55220439 GAGTGTAGAGACTCTGGAGCTGG - Intergenic
973892108 4:55377679-55377701 CAGTGCAGAGACACTGAAGCAGG - Intergenic
978352419 4:107833939-107833961 CAGTCTCCAGAATCTGGAGGAGG + Intronic
979500518 4:121434630-121434652 CAGCATGGAGACCCTGGAGCTGG + Intergenic
982456337 4:155613402-155613424 CAGTCTGGAGATGCTGGAGAAGG - Intergenic
983527437 4:168773620-168773642 GAGTGCAGAGGCTCTGGAGCTGG - Intronic
983666221 4:170187981-170188003 CAGTCTATAAAGTCTGGAGTAGG - Intergenic
987018420 5:13844914-13844936 CCTTCTAGAGATTCTGGGGCAGG - Exonic
991164212 5:63543125-63543147 AAGCACAGAGACTCTGGAGCTGG - Intergenic
992751510 5:79867065-79867087 CAGTCTGGCCACTCAGGAGCGGG - Intergenic
994088555 5:95786883-95786905 TAGTCTAGGGACTCTGTAACAGG - Intronic
995119605 5:108521656-108521678 TAGTTTATAGGCTCTGGAGCTGG - Intergenic
997209448 5:132068886-132068908 CAGAGCAGAGACTCAGGAGCAGG + Intergenic
998444287 5:142186785-142186807 TGGTCTAGAAACTCTGCAGCTGG - Intergenic
999283228 5:150378823-150378845 AAGAATACAGACTCTGGAGCTGG - Intronic
1002432493 5:179211591-179211613 CATTCTAGAGACTCTAAAACAGG - Intronic
1003961182 6:11210888-11210910 CAGCCTAGAGACCCAGGATCAGG + Intronic
1004447786 6:15716610-15716632 CAGTCCACAGAATGTGGAGCTGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1005328507 6:24725606-24725628 CAGGCTAGAGACACTGCACCCGG - Intergenic
1005704115 6:28434734-28434756 CAGTGTGGAGTCTCTGGTGCTGG + Exonic
1015350245 6:132209941-132209963 CAGTATGGAGATTCTGGTGCAGG - Intergenic
1021312953 7:19116077-19116099 CAGTCTAGAGACTCTGGAGCTGG - Exonic
1022285959 7:28956515-28956537 AGGTCTAGGGACTGTGGAGCCGG + Exonic
1023364840 7:39453228-39453250 CAGACTAGAGTTTCTGGAGAGGG - Intronic
1023834411 7:44059921-44059943 CAGTCTACAGGCTCGGGGGCTGG - Intronic
1023951885 7:44852723-44852745 CACACAAGAAACTCTGGAGCTGG - Intergenic
1029383076 7:100225941-100225963 CGGTCCAGAAACTCTGGACCTGG + Intronic
1031986762 7:128168510-128168532 CAGGGAAGAGACCCTGGAGCAGG - Intergenic
1033235815 7:139637084-139637106 CTGACTTGAGACTTTGGAGCTGG - Intronic
1034406802 7:150909372-150909394 CAGTCAAGAGTTTCTAGAGCAGG - Intergenic
1040038942 8:42897137-42897159 CAGCGTAGAGTCGCTGGAGCGGG + Exonic
1041338834 8:56820262-56820284 CACTGTTGAGATTCTGGAGCTGG - Intergenic
1049856300 8:144864117-144864139 CAGCCTAGAGCCTCTGAACCCGG - Intergenic
1050398684 9:5228104-5228126 CTGTCTCTAGAGTCTGGAGCTGG - Intergenic
1052841176 9:33292023-33292045 CAGTTTAGAGAATCTGGTGAAGG - Intronic
1053087992 9:35244515-35244537 CCGTCTAGAGGCTCTGAAGGAGG + Intronic
1055803154 9:80062872-80062894 AAGACTAGAAACTCTGTAGCTGG - Intergenic
1056748917 9:89330719-89330741 CAGCCTGGAGCCCCTGGAGCAGG - Intronic
1056767313 9:89452812-89452834 CAGTCTAGAGACAGTGCAGCAGG - Intronic
1057418198 9:94884521-94884543 CAGTGCACAGGCTCTGGAGCAGG + Intronic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1062616222 9:137397210-137397232 CTGGCGAGAGGCTCTGGAGCAGG - Intronic
1197541988 X:127775619-127775641 CAGGCTTGAGACGCTGCAGCTGG - Intergenic