ID: 1021313029

View in Genome Browser
Species Human (GRCh38)
Location 7:19116492-19116514
Sequence CGGGGTCAGACCGGCCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021313020_1021313029 -1 Left 1021313020 7:19116470-19116492 CCCTGGAGACTGCTCTCCCTAGC 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313017_1021313029 12 Left 1021313017 7:19116457-19116479 CCAGGGCGCATCCCCCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313021_1021313029 -2 Left 1021313021 7:19116471-19116493 CCTGGAGACTGCTCTCCCTAGCG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313019_1021313029 0 Left 1021313019 7:19116469-19116491 CCCCTGGAGACTGCTCTCCCTAG 0: 1
1: 0
2: 0
3: 25
4: 167
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313015_1021313029 17 Left 1021313015 7:19116452-19116474 CCTCACCAGGGCGCATCCCCCTG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313014_1021313029 18 Left 1021313014 7:19116451-19116473 CCCTCACCAGGGCGCATCCCCCT 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313013_1021313029 19 Left 1021313013 7:19116450-19116472 CCCCTCACCAGGGCGCATCCCCC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313018_1021313029 1 Left 1021313018 7:19116468-19116490 CCCCCTGGAGACTGCTCTCCCTA 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021313029 Original CRISPR CGGGGTCAGACCGGCCTTCC GGG Intronic