ID: 1021313029

View in Genome Browser
Species Human (GRCh38)
Location 7:19116492-19116514
Sequence CGGGGTCAGACCGGCCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021313021_1021313029 -2 Left 1021313021 7:19116471-19116493 CCTGGAGACTGCTCTCCCTAGCG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313013_1021313029 19 Left 1021313013 7:19116450-19116472 CCCCTCACCAGGGCGCATCCCCC 0: 1
1: 0
2: 2
3: 18
4: 250
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313014_1021313029 18 Left 1021313014 7:19116451-19116473 CCCTCACCAGGGCGCATCCCCCT 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313019_1021313029 0 Left 1021313019 7:19116469-19116491 CCCCTGGAGACTGCTCTCCCTAG 0: 1
1: 0
2: 0
3: 25
4: 167
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313017_1021313029 12 Left 1021313017 7:19116457-19116479 CCAGGGCGCATCCCCCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313020_1021313029 -1 Left 1021313020 7:19116470-19116492 CCCTGGAGACTGCTCTCCCTAGC 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313015_1021313029 17 Left 1021313015 7:19116452-19116474 CCTCACCAGGGCGCATCCCCCTG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95
1021313018_1021313029 1 Left 1021313018 7:19116468-19116490 CCCCCTGGAGACTGCTCTCCCTA 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021313029 Original CRISPR CGGGGTCAGACCGGCCTTCC GGG Intronic
900648670 1:3720499-3720521 CAGGGACAGACCAGCGTTCCTGG + Intronic
903738151 1:25543501-25543523 CGGGGCGAGACCGGCCGTCGGGG + Intergenic
903834164 1:26191904-26191926 AGGGGTCAGAGCTGGCTTCCTGG + Intronic
905394002 1:37655739-37655761 GGGGTTCAGATCAGCCTTCCTGG + Intergenic
905733716 1:40312590-40312612 CAGGGCCAGCCCGGGCTTCCTGG - Exonic
907918372 1:58891210-58891232 CGGGCTCAGATCAGCCTTCCTGG + Intergenic
913075393 1:115337565-115337587 CGGGGTCCGTCCGGCGTACCGGG - Intronic
913538666 1:119798061-119798083 CAGGCAAAGACCGGCCTTCCAGG + Intronic
1076401604 10:130188977-130188999 CCGCGTCAGACCTGCCTTCAGGG - Intergenic
1080662817 11:34311201-34311223 GGAGGTCAGACAGCCCTTCCGGG - Intronic
1081003490 11:37703393-37703415 GAGGGTCAGACCAGTCTTCCAGG + Intergenic
1082750157 11:57006271-57006293 TGGGGTCAGTGGGGCCTTCCTGG + Intergenic
1082774990 11:57237716-57237738 GGGGGCCAGACCTGCCTGCCAGG - Intergenic
1087205035 11:95385706-95385728 CTGGGTCAGCCTGTCCTTCCAGG + Intergenic
1088462291 11:110093697-110093719 CGAGGTGAGGCCGGGCTTCCCGG + Intronic
1089560322 11:119340291-119340313 CCGGGGCACCCCGGCCTTCCAGG - Exonic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1101131774 12:101697698-101697720 CGAGGTCAGGCCGGCCTGCCCGG - Exonic
1104509657 12:129365861-129365883 GGGGGGCAGCCCAGCCTTCCTGG + Intronic
1105961529 13:25345682-25345704 AGGGGTCATACAAGCCTTCCAGG - Intronic
1106902261 13:34366466-34366488 CTGGGCCAGACCGGCCTTCAGGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113457950 13:110462283-110462305 CGGGGACAGCCCGGCGTCCCAGG + Exonic
1113804366 13:113104728-113104750 AGGGGTCAGACAGGCCTGCTGGG + Intergenic
1119569992 14:75661527-75661549 CGGGGTCGTCCCGTCCTTCCCGG + Intronic
1121277741 14:92679279-92679301 CGTGGTCAGACAGGGCTGCCAGG - Intronic
1121651541 14:95562565-95562587 GGGGGTCAGGCAGGCCTCCCCGG - Intergenic
1122125977 14:99579096-99579118 CTGGGTCAGACAGGCCTCCATGG - Intronic
1122913208 14:104843779-104843801 CGGGGGCAGACACGCGTTCCCGG + Intergenic
1125738913 15:41947881-41947903 TGGGGTCAGGCAGACCTTCCTGG - Intronic
1139291612 16:65863586-65863608 CTGGCTCAGGCAGGCCTTCCAGG - Intergenic
1139842182 16:69890638-69890660 AGGAGTGAGGCCGGCCTTCCAGG - Intronic
1142157510 16:88539354-88539376 CAGGGTCAGCCCAGCCTGCCGGG + Intergenic
1142272639 16:89098589-89098611 AGGTGTCCCACCGGCCTTCCGGG + Exonic
1149958850 17:61084470-61084492 CGGGGTCAGAGCGGACTGGCTGG - Exonic
1151673817 17:75588162-75588184 CGCGGTCGGAACGGCGTTCCCGG - Intergenic
1152633349 17:81420495-81420517 CCGGGTCAGACTGGCCTCCCAGG + Intronic
1152878492 17:82801977-82801999 CGGGGTCAGCTCAGCCTCCCTGG + Intronic
1154999726 18:21674643-21674665 CTGGCTGAGACCAGCCTTCCTGG + Intronic
1158846436 18:61447775-61447797 CGGATTCAGACTGGCCATCCAGG - Intronic
1159612914 18:70546386-70546408 GGGAGTGAGACCGGCCTTTCGGG - Intergenic
1160891141 19:1379366-1379388 CGGGGTCAAGCCTGTCTTCCCGG - Intergenic
1160952530 19:1674527-1674549 TGGGGTCAGGCCTGGCTTCCCGG + Intergenic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1162413513 19:10520078-10520100 GAGGGACAGACCTGCCTTCCTGG - Intergenic
1162554254 19:11376748-11376770 CGAGGTCAGCCCGGCCTACATGG + Exonic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
1163696254 19:18765038-18765060 CGGCTTCAGACAGCCCTTCCTGG + Intronic
1166685195 19:44792507-44792529 AGGGGTCAGACCCACCTGCCAGG - Exonic
934717495 2:96552112-96552134 CCTGGTCATCCCGGCCTTCCCGG + Exonic
936935653 2:117836398-117836420 CCGGGTAAGACTGTCCTTCCAGG - Intergenic
941769655 2:169331032-169331054 CAGGGTGAAACAGGCCTTCCTGG - Intronic
946841610 2:223825485-223825507 CGGGGTCATCCCACCCTTCCAGG + Intronic
948644473 2:239395228-239395250 CAGGATCAGGCAGGCCTTCCAGG + Intronic
1168883430 20:1226152-1226174 CGGGGTCCGGCCGGCCTCTCAGG - Exonic
1175252131 20:57616209-57616231 CAGGGTCAGACCCGCCTCCCCGG + Intronic
1175470068 20:59221322-59221344 CGGGGTGAGACTTGCCCTCCAGG + Intronic
1175951332 20:62584907-62584929 CGGGACCAGACCCACCTTCCCGG + Intergenic
1179166513 21:38939343-38939365 GGGTGACAGACCTGCCTTCCTGG + Intergenic
1180085183 21:45505155-45505177 CGGGGCCAGCCCGGCCCACCTGG + Exonic
1181084157 22:20431648-20431670 CGGGGTCGGATCCGCCTTCGGGG - Intronic
1181519003 22:23434663-23434685 AGGGGCCGGTCCGGCCTTCCCGG - Intergenic
1184090647 22:42291326-42291348 TGGGGTTAGACAGGGCTTCCAGG + Intronic
1185126596 22:49014662-49014684 GGGGGCCAGACGGGCCTTCCTGG - Intergenic
1185372208 22:50466167-50466189 TGGGGTCAACGCGGCCTTCCAGG - Exonic
950121639 3:10485758-10485780 CTGGCTCAGGCCTGCCTTCCCGG + Intronic
953903090 3:46854232-46854254 CGGGCTCTGGCCAGCCTTCCTGG - Intergenic
954133347 3:48570895-48570917 CCGGGTCAGACAGGCCCTCGAGG - Exonic
955466859 3:59246383-59246405 CTGCCTCAGACAGGCCTTCCCGG + Intergenic
961896964 3:130175873-130175895 CGGGATCAGAGTGGCCTCCCAGG + Intergenic
970005239 4:11404612-11404634 CAGGTTCAAACCTGCCTTCCTGG - Intronic
978885981 4:113766827-113766849 CAGGGTCTGGCCGTCCTTCCTGG + Intergenic
985021173 4:185692179-185692201 CGGGGTCAGACAGCTCTTGCAGG - Intronic
986735345 5:10663713-10663735 CAGGGACAGAGCTGCCTTCCTGG + Intergenic
991084826 5:62639229-62639251 TGAGGTCAGACCTGCCTTGCAGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992726471 5:79612444-79612466 CGGGGTCACGTCGGTCTTCCGGG + Exonic
1000254326 5:159523548-159523570 CGGCATCAGACCACCCTTCCAGG + Intergenic
1002212865 5:177608867-177608889 CGGGGTCAGGCTGCCCTTCCTGG - Intronic
1003129895 6:3386625-3386647 AGAGCTCAGAACGGCCTTCCAGG + Intronic
1007320763 6:41027648-41027670 CGGGGTAGGACCAGGCTTCCCGG - Exonic
1007864639 6:44955389-44955411 TGGAGTGAGACCGGCCTTTCGGG + Intronic
1017727998 6:157288861-157288883 CAGGCTCAGAGTGGCCTTCCAGG - Intergenic
1019428674 7:988729-988751 TGGCGTCAGTCCGGCCTCCCTGG + Exonic
1019592278 7:1841663-1841685 AGGGGCCAGTCCGGCCTTCCCGG + Intronic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1024394290 7:48848176-48848198 CGGGCACAGAGCGGCCTTGCGGG + Intergenic
1027378362 7:77576951-77576973 TGGGGTCAGCCAGGCCTTCCAGG - Intronic
1029449618 7:100633499-100633521 CTGAGTCAGAGCGGCCATCCCGG + Exonic
1031836361 7:126685484-126685506 AGGGGTCAGAGGGGCCTTCCTGG - Intronic
1037821922 8:22139244-22139266 TGGAGTCAGACCTTCCTTCCTGG - Intronic
1037898229 8:22672431-22672453 ACGGGTCAGACAGGCGTTCCTGG - Intergenic
1039474531 8:37832870-37832892 GGGGTTCAGACCAGCCTTCCAGG - Intronic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1051592781 9:18793454-18793476 CTGGGGCAGACCTGACTTCCAGG + Intronic
1052989006 9:34507783-34507805 CAGGGGCAGACCTGCCTACCAGG - Intronic
1060481212 9:124017795-124017817 CGGGGTCGGAAAGTCCTTCCGGG + Intronic
1061087182 9:128405940-128405962 AGGTGCCAGACCGCCCTTCCCGG - Intergenic
1061203213 9:129148844-129148866 CAGGGCCAGACAGCCCTTCCTGG + Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061484474 9:130913414-130913436 TCGGGTCAGACCGGGCATCCGGG - Intronic
1190596828 X:52060021-52060043 AAGGGTCAGACCGGCCACCCTGG - Intergenic
1190611996 X:52194052-52194074 AAGGGTCAGACCGGCCACCCTGG + Intergenic
1192232076 X:69272316-69272338 CGGAGTCAGGCAGTCCTTCCAGG - Intergenic
1192503572 X:71668052-71668074 GGGTGCCAGGCCGGCCTTCCTGG - Intergenic
1192510786 X:71719372-71719394 GGGTGCCAGGCCGGCCTTCCCGG - Intergenic
1192515911 X:71762181-71762203 GGGTGCCAGGCCGGCCTTCCCGG + Intergenic
1193541285 X:82775573-82775595 GGGAGTCAGACCGGCCTTTTGGG - Intergenic
1195793944 X:108622690-108622712 CAGGGTCAGCCAGGACTTCCTGG + Exonic
1200079706 X:153570158-153570180 CGGGCTCAGGGCCGCCTTCCCGG + Intronic