ID: 1021313033

View in Genome Browser
Species Human (GRCh38)
Location 7:19116502-19116524
Sequence CCCCAGCGTCCCCGGAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021313033_1021313047 27 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313047 7:19116552-19116574 GGGAAGGCTGAGCGGAGAGTGGG 0: 1
1: 0
2: 1
3: 36
4: 369
1021313033_1021313046 26 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313046 7:19116551-19116573 TGGGAAGGCTGAGCGGAGAGTGG 0: 1
1: 0
2: 4
3: 43
4: 534
1021313033_1021313040 3 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313040 7:19116528-19116550 CGAGGCAACGGTGCCAAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1021313033_1021313042 7 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313042 7:19116532-19116554 GCAACGGTGCCAAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1021313033_1021313039 -9 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313039 7:19116516-19116538 ACGCTGGGGGCGCGAGGCAACGG 0: 1
1: 0
2: 0
3: 7
4: 99
1021313033_1021313045 19 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313045 7:19116544-19116566 AGTGAGGTGGGAAGGCTGAGCGG 0: 1
1: 0
2: 5
3: 71
4: 669
1021313033_1021313043 11 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313043 7:19116536-19116558 CGGTGCCAAGTGAGGTGGGAAGG 0: 1
1: 0
2: 2
3: 10
4: 201
1021313033_1021313041 6 Left 1021313033 7:19116502-19116524 CCGGCCTTCCGGGGACGCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 1021313041 7:19116531-19116553 GGCAACGGTGCCAAGTGAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021313033 Original CRISPR CCCCAGCGTCCCCGGAAGGC CGG (reversed) Intronic
900604903 1:3519595-3519617 CACCAGAGTCCCGGGAGGGCAGG + Intronic
900633277 1:3649867-3649889 TGCCAGCGTCCCCGGCGGGCAGG - Intronic
900799788 1:4730082-4730104 CCACAGCGTCCGCAGAGGGCAGG + Intronic
901019823 1:6249921-6249943 CCCCAGCGCGGCAGGAAGGCGGG + Exonic
902089660 1:13893156-13893178 CCCCAGGGTCCCCGGGGAGCTGG - Intergenic
902323497 1:15684081-15684103 CCCCGAGGTCCCCGGCAGGCGGG + Intergenic
905884307 1:41483554-41483576 CCCCATCCTCCCCATAAGGCAGG - Intronic
907190007 1:52640561-52640583 CCTCAGCCTCCCTGGTAGGCGGG - Intronic
907406668 1:54258027-54258049 GCCCCGCGTCCCCGGCGGGCGGG + Intronic
912370809 1:109172660-109172682 CCCCAATGTCCCTGGAGGGCAGG + Intronic
914197386 1:145454541-145454563 GCCCAGCGGCCCCGGCAGGGAGG + Intergenic
915556404 1:156663312-156663334 CCCCAGAGCCCCAGGAAGGGTGG - Intergenic
917740842 1:177960759-177960781 ACCCAGTGTCCCTGGAATGCTGG - Intronic
917801976 1:178579880-178579902 CCCCAGCAGCCCTGGCAGGCAGG - Intergenic
919940161 1:202280941-202280963 CCCCAGCATCCCAGGACTGCTGG - Intronic
921875987 1:220197100-220197122 CCTCAGCCTCCCCGAATGGCTGG + Intronic
922443571 1:225677534-225677556 GCCCAGCCTCTCCGGAGGGCTGG + Intergenic
923136178 1:231121708-231121730 CCCCAGCATCCCCAGAAGGAGGG - Intergenic
1064202890 10:13299706-13299728 CCCCAGGGATCCCGGAGGGCAGG + Intronic
1065054386 10:21829327-21829349 CCTCAGCCTCCCGGGTAGGCGGG + Intronic
1067078239 10:43200066-43200088 CCCGAGCGTCTCCGGAGTGCTGG - Intronic
1068669710 10:59710207-59710229 CGCCAGCGGCCCCGGGAGCCAGG - Intronic
1069937737 10:71930055-71930077 CCTCAGCCTCCCAAGAAGGCAGG + Intergenic
1072629591 10:97135966-97135988 CCCCAAGGACCCCGGAATGCAGG - Intronic
1073124337 10:101140331-101140353 TCCCAGCGTCCCCAGGAGTCTGG - Intergenic
1073423936 10:103444984-103445006 CCCCAGCGTCTCCACAAGACAGG + Intronic
1074545281 10:114397641-114397663 CCCAAGCAAGCCCGGAAGGCTGG + Intronic
1074587220 10:114779942-114779964 CCACAGCCTCCCTGGAAGGCAGG - Intergenic
1076556221 10:131322962-131322984 CCCCAGCATCCCAGAAAAGCAGG + Intergenic
1076639036 10:131901405-131901427 CCCAAGCGTCCGTGGAAGGCAGG + Intronic
1076687828 10:132206019-132206041 CCCGAGCCACCCCAGAAGGCCGG + Intergenic
1076738712 10:132470396-132470418 CGCAAGTGTCCCGGGAAGGCAGG - Intergenic
1076881463 10:133241540-133241562 CCCCAGAGTGCCCAGGAGGCAGG + Exonic
1077325646 11:1962882-1962904 CCCCAGCGTCCACGGAGGCCAGG - Intronic
1077683519 11:4269405-4269427 CCCCAGTGTGTCTGGAAGGCAGG - Intergenic
1077686521 11:4297358-4297380 CCCCAGTGTGTCTGGAAGGCAGG + Intergenic
1077691675 11:4348546-4348568 CCCCAGTGTGTCTGGAAGGCAGG + Intergenic
1083622845 11:64057476-64057498 CCCCAGCCAGCCAGGAAGGCTGG + Intronic
1083628775 11:64085393-64085415 GCCCTCCGTCCCCGGAAGGCAGG - Intronic
1084524494 11:69687104-69687126 CCCCAGTGTCTGGGGAAGGCAGG + Intergenic
1084677027 11:70641511-70641533 CCCCAGCCTCCCCTGCAGGGAGG + Intronic
1084977984 11:72813893-72813915 CGCCATCATCCCCGGAAAGCGGG + Intergenic
1089180405 11:116579628-116579650 ACCCAGGGTCCCCGGAACCCTGG - Intergenic
1089274830 11:117327875-117327897 CCCCGGCGTCCCTGGAAGCTGGG + Exonic
1089507270 11:118972090-118972112 CCCAAGCCTCCCCGGGAGGTGGG - Intronic
1089560317 11:119340281-119340303 GCCCGGCGTGCCTGGAAGGCCGG + Exonic
1089683144 11:120130615-120130637 CCACAGCTTCCCTGGAAGGCAGG - Intronic
1090013143 11:123062489-123062511 CCCCAGCTTCCGCGGGAGGGAGG + Intronic
1202808626 11_KI270721v1_random:18061-18083 CCCCAGCGTCCACGGAGGCCAGG - Intergenic
1091673176 12:2467470-2467492 TCCCAGCCTCCCCAGAAGGGAGG + Intronic
1092002553 12:5044247-5044269 CTCCAGTGTCCCCCGACGGCTGG + Exonic
1095339607 12:41074054-41074076 CCTCAGAGTCTCCAGAAGGCAGG - Intergenic
1096280148 12:50245739-50245761 AGCCAGCGTCCCCTGGAGGCTGG + Intronic
1098653793 12:73005279-73005301 CCCCAGAGTCCCTGGAACTCTGG - Intergenic
1101716774 12:107319065-107319087 ACCCGGCGTCCCCGTATGGCGGG + Exonic
1103494748 12:121352858-121352880 TCCCAGCTTCTCGGGAAGGCGGG - Intronic
1103806737 12:123579687-123579709 CCTCAGCCTCCCCAGAATGCTGG - Intergenic
1106186271 13:27412588-27412610 CCCCAGGGCACCCAGAAGGCTGG + Intergenic
1108314558 13:49224616-49224638 CCTCAGCCTCCCCAGTAGGCAGG + Intergenic
1108596731 13:51955946-51955968 CCCCAGAGTCCATGGCAGGCAGG - Intronic
1110860849 13:80342900-80342922 CCCGAGCGTCCCGGGACTGCGGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1112381400 13:98894112-98894134 CCCCAGCCTCCACTGAAGACAGG + Intronic
1113695544 13:112343112-112343134 CCCCAGCCTCCCGGGAATCCAGG + Intergenic
1114092552 14:19302514-19302536 CCACCGCGTCCCGGGATGGCGGG + Intergenic
1118272389 14:64355593-64355615 CCCTAGCGTCCCTGGGAGACTGG + Intergenic
1119778071 14:77260442-77260464 CTCCAGGGTCCCCAGATGGCAGG + Intergenic
1120671246 14:87365300-87365322 CCCCAGTGTGTCTGGAAGGCAGG - Intergenic
1121460637 14:94073925-94073947 CCCCAGCGTCCCAGGTAGCTGGG - Intronic
1121981267 14:98456635-98456657 CCACAGTGACCCAGGAAGGCAGG + Intergenic
1122652527 14:103233222-103233244 CCCCAGCGCCCCCAGCAGCCCGG + Intergenic
1122811472 14:104291470-104291492 CCCCAGGGACCCCTGAAGGGGGG - Intergenic
1123964059 15:25438412-25438434 CCACAGCGGGCCCCGAAGGCCGG + Intronic
1124157824 15:27243453-27243475 CTCCAGCGTCCCCTGCAAGCAGG - Intronic
1125833037 15:42729660-42729682 CCCCAGCGCACCCAGAAAGCAGG + Intronic
1127414937 15:58749218-58749240 CCCTGGCGGCCCCGGGAGGCGGG - Intronic
1128069115 15:64783021-64783043 GCCCAGCATGCCCGGGAGGCTGG + Intergenic
1128379126 15:67098751-67098773 CTCCACAGCCCCCGGAAGGCAGG + Intronic
1128535500 15:68487040-68487062 CCCCAGGTTCCCCAGGAGGCTGG + Intergenic
1129344177 15:74906407-74906429 CCGCCGCGTCTCCCGAAGGCTGG + Intronic
1131215026 15:90529703-90529725 CCCCAGCGTTCCCCGTACGCCGG + Intergenic
1132615827 16:840727-840749 CTCCATGGCCCCCGGAAGGCAGG + Intergenic
1132769767 16:1554869-1554891 CGCCAGCGTGGCCAGAAGGCAGG - Exonic
1133219825 16:4315421-4315443 CCCCTGCGGCCCCGGGCGGCGGG - Exonic
1133306340 16:4811979-4812001 CCCCAGGGTCCCCGGCAGAAAGG + Intronic
1134143563 16:11742590-11742612 CCACAGCGTCCTCGGCGGGCCGG - Exonic
1135912229 16:26571926-26571948 CCCTAGTGTACCTGGAAGGCAGG - Intergenic
1136220302 16:28823797-28823819 GCCCCGCCTCCCCTGAAGGCCGG - Intronic
1136261728 16:29082077-29082099 CCTCCCCGGCCCCGGAAGGCGGG - Intergenic
1137426389 16:48384866-48384888 CCCCCGCGCGCCCGGGAGGCGGG - Intronic
1138595299 16:58026362-58026384 CCCGAGCGCGCCCGGACGGCCGG + Exonic
1141137121 16:81473700-81473722 TCCCCGCGTCCCCCAAAGGCAGG - Intronic
1141890814 16:86925434-86925456 CCCCTGCCTCCCTGGAAGCCAGG - Intergenic
1142247495 16:88976662-88976684 CCCCGGGGTCCCAGGAAGGGCGG - Exonic
1142509891 17:386439-386461 CCCCAGCCTCCCCGGCAGTCGGG + Intergenic
1142549941 17:732407-732429 CCCCGGCGTCCCCGGCGGGCGGG - Exonic
1142594815 17:1024352-1024374 CCCAACCGGCCACGGAAGGCAGG + Intronic
1143125422 17:4638680-4638702 CCCCATCCTGCCCTGAAGGCTGG - Exonic
1146639764 17:34531311-34531333 CCCCAGCTCCCTCGGATGGCTGG - Intergenic
1146903125 17:36601111-36601133 CCCCAGCGATCCAGGAAGGCAGG - Intergenic
1147489651 17:40853592-40853614 CCCCAGAGTCCCCGGGAAGATGG + Intergenic
1147971364 17:44220261-44220283 CCCGAGCCTCCCCGGACGCCGGG - Intronic
1150281630 17:63932414-63932436 CCCCAGGGTCCCCGGAGAGCTGG - Intergenic
1151148678 17:72065057-72065079 CCCCATCGTGCCAAGAAGGCTGG - Intergenic
1151763790 17:76121972-76121994 CCGCAGCGTCCCCGGTTGCCTGG - Intergenic
1151798924 17:76365970-76365992 CCCCTCCGTCCCCGGAAGTCAGG - Intronic
1151932317 17:77240439-77240461 CACCAGCCTCCCCGGGGGGCAGG + Intergenic
1152031236 17:77844847-77844869 CTCCAGCGGTCACGGAAGGCGGG - Intergenic
1152245453 17:79182768-79182790 CCCCCGCCTCCCCGGAGGCCCGG + Intronic
1152559477 17:81070772-81070794 TCCCAGCGTCCCAGGCAGACGGG - Intronic
1153891847 18:9524128-9524150 CCTCAGCCTCCCCGGTAAGCTGG - Intronic
1156221405 18:35055837-35055859 CCCCAGCCTCCCCAGTAGGTAGG - Intronic
1158435812 18:57435267-57435289 CCGCAGCTGCCCCGGGAGGCGGG - Intergenic
1159700221 18:71617281-71617303 CCCCAGCCTCCCCAGAAGCTGGG + Intergenic
1160021348 18:75184220-75184242 CCCCATCGTCACTGGAAGGCTGG + Intergenic
1160143529 18:76346965-76346987 ACCCAGTGTCCCCGGGAGCCAGG - Intergenic
1160653429 19:246607-246629 CCTCCGCGTCCCCGGAGGGGAGG + Intergenic
1161552847 19:4923687-4923709 CCCCAGTGTCCCCTGGAGGGTGG - Intronic
1161770308 19:6227309-6227331 GCCCAGGGTCCCAGGATGGCTGG + Intronic
1162808229 19:13150048-13150070 CCCCAGCGTGCCCGGCGGGCTGG - Intronic
1163126865 19:15249003-15249025 CCCCAGAGAACCAGGAAGGCTGG + Intronic
1164941706 19:32256066-32256088 CCCCAGCGTCCCCAGTAGCTGGG - Intergenic
1166986899 19:46665993-46666015 CCCCAGCCTCCCCAGTAGCCAGG - Intergenic
1167416974 19:49379327-49379349 CCTCAGCCTCCCAGGTAGGCAGG + Intergenic
1167470333 19:49672221-49672243 CCACAGCGACCCCCCAAGGCAGG - Intronic
925024718 2:598760-598782 CACCAGTGTCTCCTGAAGGCTGG - Intergenic
925305138 2:2842817-2842839 CCCCAGGGTGCCTGGAAGGTGGG + Intergenic
925599244 2:5591029-5591051 CCCTAGCGTCAGCTGAAGGCTGG - Intergenic
926190177 2:10722070-10722092 CCGCGGCGTCTCCGGACGGCTGG - Intronic
926313994 2:11696359-11696381 CCCCAGCTTCCCATGCAGGCTGG + Intronic
929000831 2:37345221-37345243 CCCTAGCGGCCCCGGAGCGCCGG - Intronic
930845610 2:55900354-55900376 CCGGAGCATCCCGGGAAGGCTGG - Intronic
932588756 2:73050069-73050091 CCCCAGTGTGTCTGGAAGGCAGG - Intronic
935756800 2:106282688-106282710 TCCCAGCGTCCCCAGAAGGCAGG + Intergenic
936457609 2:112687327-112687349 CTCCAGCATCCCCGGGAGGCAGG + Intergenic
940304222 2:152208245-152208267 CCTCAGCCTCCCCGGTAGGTGGG - Intergenic
940507740 2:154577679-154577701 CTCCAGGCTCCCCGGAAGGTCGG - Intergenic
945948054 2:216013341-216013363 CCCCACCGGCGCCGGAAGCCTGG + Exonic
948055256 2:235005857-235005879 TCCCAGGGTCCCAGGCAGGCTGG + Intronic
948197064 2:236104128-236104150 CCCCAGGAGCCCCGCAAGGCGGG + Intronic
948431526 2:237922165-237922187 CCCCACCTTCCCCGGCAGGCTGG - Intergenic
948614593 2:239190351-239190373 CTCCACCCTCCCCGGGAGGCCGG + Intronic
1169578264 20:6990431-6990453 CCCCAGAGCCTCCGGAAGGAGGG + Intergenic
1171097203 20:22343575-22343597 CACCAGGGTACCCTGAAGGCTGG + Intergenic
1171249424 20:23637292-23637314 GCCCAGCGTCCCAGGAGGTCGGG + Intronic
1172460325 20:35113382-35113404 CCCCAGCGTCCCAAGAAGCTGGG - Intergenic
1172992288 20:39045522-39045544 CACCAGTGGCCCCGGGAGGCAGG + Intergenic
1174287811 20:49484375-49484397 CCCCGGCCTCCCCGGCAGGCTGG - Intergenic
1175157068 20:56978318-56978340 CCACGGCTTCCCCGCAAGGCTGG - Intergenic
1175243047 20:57563657-57563679 CCCCAGCCTCCCCGGGTGGAAGG + Exonic
1175852156 20:62099379-62099401 CTGCAGAGTCCCCTGAAGGCTGG - Intergenic
1175856507 20:62123244-62123266 TCCCGGCGTCTCCCGAAGGCTGG + Intronic
1176414356 21:6466546-6466568 CACGTGCGTCCCGGGAAGGCGGG + Intergenic
1178544194 21:33479717-33479739 CCCCACAGCCCCCAGAAGGCCGG + Intronic
1178761005 21:35402947-35402969 CACCAGCATCCCCAGAAGCCAGG - Intronic
1179550510 21:42140738-42140760 CCTGAGCCTCCCCGGGAGGCAGG + Intronic
1179689854 21:43074868-43074890 CACGTGCGTCCCGGGAAGGCGGG + Intronic
1180043593 21:45292796-45292818 CCCCAGCGACCCCTGAGAGCAGG + Intergenic
1180188486 21:46151790-46151812 CCCCGGGGTCCCGGGAAGGAGGG + Intronic
1180488177 22:15820052-15820074 CCACCGCGTCCCGGGATGGCGGG - Intergenic
1181180301 22:21063095-21063117 CCTCAGCGTCCCTTGTAGGCTGG - Intronic
1184264066 22:43337403-43337425 ACCCAGTGTCCCGGAAAGGCGGG - Intronic
1184378113 22:44127898-44127920 CCTCAGCTTCCCCGGGAAGCTGG + Intronic
1185046659 22:48531843-48531865 CCCCAACTCCCCCGGAAGGACGG + Intronic
1185254342 22:49823984-49824006 CCCCAGCGCCCACGGCACGCCGG - Exonic
1185406761 22:50656558-50656580 CCCCAGGCTCCCCTGAAGGGAGG + Intergenic
949533479 3:4978788-4978810 CCCCAGCCTCTGGGGAAGGCTGG + Intergenic
949657579 3:6238435-6238457 CCACAGTGTGCCCAGAAGGCAGG + Intergenic
950184262 3:10935298-10935320 CCACAGCGTCCCCTTGAGGCAGG - Intronic
950424880 3:12919752-12919774 CCCCAGGGTCCCCGGAAGGAAGG - Intronic
950606419 3:14085052-14085074 CCCCAGCCTCCCAAGAAGGTAGG - Intergenic
953413877 3:42704552-42704574 CCCCAGAGGCCCAGAAAGGCTGG + Intronic
953508503 3:43510313-43510335 CCTCAGCCTCCCCAGTAGGCAGG - Intronic
953751979 3:45615992-45616014 CCCTAGAGGCCCCTGAAGGCTGG - Intronic
955732870 3:62005816-62005838 CCCCAGCTTCCCAGGAAGCTGGG + Intronic
956745890 3:72310828-72310850 CCCCAGAGTGCCTGCAAGGCAGG + Intergenic
967959651 3:194910294-194910316 CCAGAGCCTCCCCGGAAGCCAGG - Intergenic
968912953 4:3485139-3485161 CCCAAGCAAGCCCGGAAGGCAGG + Intronic
969608330 4:8213218-8213240 TGCCAGCCTCCCCAGAAGGCTGG - Intronic
971117449 4:23664618-23664640 CCCCAGTGTGCCCAGAAGGTGGG + Intergenic
971919187 4:32914423-32914445 CCTCAGCCTCCCCAGTAGGCTGG - Intergenic
977600519 4:98929501-98929523 TCCCATCTTCCCCGGAAGGTTGG + Intronic
978460427 4:108945777-108945799 CCTCAGCCTCCCCAGTAGGCTGG + Intronic
978503468 4:109433558-109433580 CCGCAGCGCCCCCTGCAGGCCGG - Intergenic
978795793 4:112706159-112706181 CCTCCCCGGCCCCGGAAGGCGGG + Intergenic
979890189 4:126082418-126082440 CCTCAGCCTCCCCGGCAGCCTGG - Intergenic
982783214 4:159512603-159512625 CCCCAGCTTCCCTGGTAGGTAGG - Intergenic
983484557 4:168318433-168318455 CCCCTGCTGGCCCGGAAGGCCGG - Intronic
984431940 4:179661249-179661271 CCCCAGTGTGTCCAGAAGGCTGG + Intergenic
985964514 5:3329755-3329777 CCCCAGCAACCCCGGAGGGTAGG - Intergenic
986098345 5:4582318-4582340 TCCCAGCCTCCACAGAAGGCAGG + Intergenic
986738144 5:10682594-10682616 CACCAGCGTCCCTGCAGGGCAGG + Intronic
988868965 5:35367059-35367081 CCCCTGAGTCCAAGGAAGGCAGG + Intergenic
990811582 5:59731132-59731154 CCTCAGCTTCCCTGGAAGGTAGG + Intronic
993503321 5:88685105-88685127 CCCCAGCGTCCCAGGGGAGCCGG + Intergenic
995032513 5:107495753-107495775 TCCAAGCATCCCCGGAAGTCAGG + Intronic
1000337993 5:160255667-160255689 CCGCAGCGACCACAGAAGGCTGG + Exonic
1000410836 5:160934047-160934069 CCCCTGTGGCCCCTGAAGGCAGG - Intergenic
1001400543 5:171443907-171443929 CCACAGCTGCCCCGGAAGGAAGG - Intronic
1001538848 5:172522873-172522895 CCTCAGCGTCTCCGAGAGGCTGG + Intergenic
1002119434 5:176990787-176990809 CCCCAGCTTCCCAGGTAGGTAGG + Intronic
1002575614 5:180172248-180172270 CCCCAGCATGCCCAGATGGCTGG + Intronic
1002632470 5:180590872-180590894 CGCCGGGGTCCCCAGAAGGCAGG + Intronic
1003139064 6:3456460-3456482 CCGCCGCGTCCCCGGGCGGCAGG + Exonic
1003778780 6:9399034-9399056 CCCCAGCGTCCTCGGAGGGAAGG - Intergenic
1004935500 6:20503814-20503836 CCTCAGCCTCCCCGGTAGCCGGG - Intergenic
1006031614 6:31180503-31180525 CCTCAACCTCCCCGGAGGGCTGG + Intronic
1006389959 6:33752377-33752399 CCCCCTCGTGCCTGGAAGGCAGG - Intergenic
1006495778 6:34422428-34422450 CCCCAGCCTCCCCAGTAGGTGGG + Intronic
1011054814 6:83193559-83193581 CCCCGGCTTCCCAGGAACGCAGG - Intronic
1013116327 6:107106374-107106396 TCCCAGCTTCCTTGGAAGGCTGG - Intronic
1015023122 6:128500990-128501012 CCTCAGCCTCCCAGGTAGGCTGG + Intronic
1017309292 6:152957364-152957386 CCCCAGTGTACCCAGAAGGTGGG + Intergenic
1017567162 6:155699723-155699745 CCCCAGCCTCCCCGTCAGCCAGG - Intergenic
1019048662 6:169167165-169167187 CCACTGCGGCCCCGGCAGGCGGG + Intergenic
1019300877 7:302857-302879 CCTCAGCCTCCCCGGAAGCTGGG + Intergenic
1019322724 7:422942-422964 GCCCAGTGTCCCCAGAGGGCCGG + Intergenic
1019400309 7:848213-848235 CCCCAGGGTACCCCGAAGACTGG - Intronic
1019767699 7:2863701-2863723 GCCCAGCGTCTCCGGAGGACTGG - Intergenic
1020093517 7:5354825-5354847 CCCCAACGACCCCGTAAAGCAGG + Intronic
1020133891 7:5575158-5575180 CCCCAGGGTCACCAGGAGGCTGG + Intergenic
1020461491 7:8434047-8434069 CCAGAGCGTCCCCGGGTGGCCGG + Exonic
1021313033 7:19116502-19116524 CCCCAGCGTCCCCGGAAGGCCGG - Intronic
1022014395 7:26336587-26336609 CCTCAGCCTCCCCGGTAGGTGGG - Intronic
1023567745 7:41540484-41540506 CCTCAGCCTCCTCGGAAGGTGGG - Intergenic
1024216504 7:47253667-47253689 CCCCTCCTTCCCCAGAAGGCAGG - Intergenic
1024489192 7:49957954-49957976 CCCCAGTGTGCCCAGAAGGCAGG + Intronic
1026360499 7:69598230-69598252 CCCCCGCGGCCCCGGCCGGCGGG - Intergenic
1026938917 7:74275457-74275479 CCACAGTGTCCCCTGCAGGCAGG - Intergenic
1029218246 7:98968132-98968154 CCCCAGCCTCCCCGGTAGCTGGG + Intronic
1029294974 7:99533282-99533304 CCCCAACCTTCCTGGAAGGCAGG - Exonic
1029459107 7:100685304-100685326 CCCCAGCGCACCCGGGAGGTAGG + Intronic
1029522373 7:101071444-101071466 CCTCAGCCTCCCCGGTAGCCGGG - Intergenic
1029986823 7:104930342-104930364 CCCCAGAGTGCTGGGAAGGCTGG + Intergenic
1033211551 7:139463686-139463708 CCCCAGAGTCCCTGGAACTCCGG + Intronic
1033214506 7:139483652-139483674 CCTCAGCGTCTCCGGGTGGCGGG - Exonic
1035512950 8:206341-206363 CCTCCGCGTCCCCGGAGGGGAGG + Intergenic
1035627605 8:1083339-1083361 CCCCTGCCTCTCCGAAAGGCTGG - Intergenic
1036201442 8:6774191-6774213 CCCCGGCCTCCCCAGAAGACAGG - Intergenic
1036707568 8:11056582-11056604 CCCCAGCTTCCCCGGAACTGGGG + Intronic
1039079463 8:33721361-33721383 CCCCAGAGTGCCCAGGAGGCAGG - Intergenic
1039155699 8:34554231-34554253 CCCCAGTGTGTCTGGAAGGCAGG + Intergenic
1041016075 8:53594447-53594469 CCCCAGGGTCCACGGAGGGTGGG - Intergenic
1047529625 8:125663291-125663313 CCTCAGTGTCCCCAGAAGCCTGG - Intergenic
1048302490 8:133261713-133261735 CCCCAGCCTTCCTGCAAGGCTGG - Intronic
1048838763 8:138546628-138546650 ACCCAGAGCCCCAGGAAGGCAGG + Intergenic
1048997542 8:139803725-139803747 CCCCGGAGTCACTGGAAGGCAGG + Intronic
1049328996 8:142039697-142039719 GCCCTGGGTCCCCGGATGGCTGG - Intergenic
1049371631 8:142270745-142270767 GCCCAGCGTCCCTGGAAGCAGGG - Intronic
1049406204 8:142452815-142452837 CCGCGGCGTCCCCGGAGGACGGG - Intronic
1049707098 8:144048051-144048073 CCCAGGCATCCCCGGAGGGCCGG - Intergenic
1049721260 8:144116509-144116531 CACCAGCGTTCCCGGAGGGGTGG + Exonic
1050246232 9:3693204-3693226 CCTCAGCGTCCCGAGAAGCCAGG - Intergenic
1052795711 9:32921802-32921824 GCCCAGCGTCCCTGGAACACAGG + Intergenic
1053306165 9:36986155-36986177 CCCCCGGGGCCCCGGAAAGCTGG + Intronic
1055416829 9:76092511-76092533 CCCCAGCCTCCCCAGAAGCCAGG + Intronic
1055530280 9:77177263-77177285 CCCCAGCGGCCCCCCAGGGCGGG - Intergenic
1056767832 9:89455548-89455570 CACCAGCTTCCCCGGCAGGAAGG - Intronic
1056960371 9:91117614-91117636 TGACCGCGTCCCCGGAAGGCAGG - Intergenic
1057198017 9:93125798-93125820 CCTCAGCCTCCCAGGTAGGCTGG - Intronic
1057453667 9:95188268-95188290 TCCCAGGCTCCCAGGAAGGCAGG + Intronic
1058836588 9:108863027-108863049 GCCCAGCATCACCGGAAGGCTGG + Exonic
1060818476 9:126648314-126648336 CCCTAGCCTCCCTCGAAGGCAGG + Intronic
1061174327 9:128983934-128983956 CCTCAGCCTCCCCGGTAGCCAGG + Intronic
1061295071 9:129672506-129672528 CCCCAGCATTCCCGGGAGCCAGG - Intronic
1062023780 9:134331170-134331192 CCTCAGAGTCCCAAGAAGGCAGG + Intronic
1062037637 9:134389814-134389836 CCCCAGGGGCCTCGGAAGGAAGG - Intronic
1062231598 9:135484990-135485012 CGCCTGCGGCCCTGGAAGGCTGG - Exonic
1062352479 9:136145851-136145873 CCCCAGGGTGCCGGGAAGCCAGG - Intergenic
1062490028 9:136800498-136800520 GCCCAGCGGCCCGGGAAGGGCGG + Exonic
1062599443 9:137313338-137313360 CCCCAGGGTGGCCGGCAGGCAGG - Intronic
1062696296 9:137877884-137877906 GCCCAGCGGCCCCGGCAGGGAGG - Exonic
1186618716 X:11215300-11215322 CCCCAGCGACCCCGTGTGGCCGG - Intronic
1187464540 X:19515476-19515498 CCCCAGCGCCCTTTGAAGGCCGG + Intergenic
1188141799 X:26559186-26559208 CCCCAGAGTGCCCAGGAGGCAGG + Intergenic
1188238003 X:27752603-27752625 CCCCAGCCTCCCAGGTAGGAGGG + Intergenic
1191688998 X:63920898-63920920 TCCCAGCGTTCCAGGAAGGTAGG - Intergenic
1194116084 X:89900041-89900063 CCCAAGTGTGCCCAGAAGGCAGG + Intergenic
1198518436 X:137429939-137429961 CCCCTGCGTCCCCGGAACCCTGG - Intergenic
1200209015 X:154337554-154337576 CACCAGAGTCCCAGGAAGCCAGG + Intergenic
1200221861 X:154394575-154394597 CACCAGAGTCCCAGGAAGCCAGG - Intronic
1200468882 Y:3557166-3557188 CCCAAGTGTGCCCAGAAGGCAGG + Intergenic
1200844678 Y:7819593-7819615 TCCCAGTGTCCCCAGTAGGCAGG + Intergenic
1202267641 Y:23037515-23037537 TCCCAGTGTCCCCAGTAGGCAGG - Intergenic
1202420633 Y:24671259-24671281 TCCCAGTGTCCCCAGTAGGCAGG - Intergenic
1202450153 Y:24998823-24998845 TCCCAGTGTCCCCAGTAGGCAGG + Intergenic