ID: 1021313487

View in Genome Browser
Species Human (GRCh38)
Location 7:19118295-19118317
Sequence ACGCAAATCCTCAGCCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021313487_1021313491 3 Left 1021313487 7:19118295-19118317 CCGCGGGGGCTGAGGATTTGCGT No data
Right 1021313491 7:19118321-19118343 GGCCTGCTCTCTCGCCCTTCTGG No data
1021313487_1021313492 4 Left 1021313487 7:19118295-19118317 CCGCGGGGGCTGAGGATTTGCGT No data
Right 1021313492 7:19118322-19118344 GCCTGCTCTCTCGCCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021313487 Original CRISPR ACGCAAATCCTCAGCCCCCG CGG (reversed) Intergenic
No off target data available for this crispr