ID: 1021329335

View in Genome Browser
Species Human (GRCh38)
Location 7:19315858-19315880
Sequence AATCCTTCCCCACTGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021329330_1021329335 12 Left 1021329330 7:19315823-19315845 CCCACTTTCTGTGTCTGTTAAGT No data
Right 1021329335 7:19315858-19315880 AATCCTTCCCCACTGCAGACAGG No data
1021329331_1021329335 11 Left 1021329331 7:19315824-19315846 CCACTTTCTGTGTCTGTTAAGTC No data
Right 1021329335 7:19315858-19315880 AATCCTTCCCCACTGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021329335 Original CRISPR AATCCTTCCCCACTGCAGAC AGG Intergenic
No off target data available for this crispr