ID: 1021329561

View in Genome Browser
Species Human (GRCh38)
Location 7:19318750-19318772
Sequence ATGTTGATCTATGGCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021329557_1021329561 16 Left 1021329557 7:19318711-19318733 CCCAATGGCTAACAGGAATAAGA No data
Right 1021329561 7:19318750-19318772 ATGTTGATCTATGGCACAGAAGG No data
1021329558_1021329561 15 Left 1021329558 7:19318712-19318734 CCAATGGCTAACAGGAATAAGAA No data
Right 1021329561 7:19318750-19318772 ATGTTGATCTATGGCACAGAAGG No data
1021329556_1021329561 17 Left 1021329556 7:19318710-19318732 CCCCAATGGCTAACAGGAATAAG No data
Right 1021329561 7:19318750-19318772 ATGTTGATCTATGGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021329561 Original CRISPR ATGTTGATCTATGGCACAGA AGG Intergenic
No off target data available for this crispr