ID: 1021333555

View in Genome Browser
Species Human (GRCh38)
Location 7:19369610-19369632
Sequence CAGAGACATCATGTTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021333555_1021333561 29 Left 1021333555 7:19369610-19369632 CCAGGTCCAACATGATGTCTCTG No data
Right 1021333561 7:19369662-19369684 TCACGAGTCAGTATCTAAGTTGG No data
1021333555_1021333559 -9 Left 1021333555 7:19369610-19369632 CCAGGTCCAACATGATGTCTCTG No data
Right 1021333559 7:19369624-19369646 ATGTCTCTGAACGTGGAGCTGGG No data
1021333555_1021333558 -10 Left 1021333555 7:19369610-19369632 CCAGGTCCAACATGATGTCTCTG No data
Right 1021333558 7:19369623-19369645 GATGTCTCTGAACGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021333555 Original CRISPR CAGAGACATCATGTTGGACC TGG (reversed) Intergenic
No off target data available for this crispr