ID: 1021336913

View in Genome Browser
Species Human (GRCh38)
Location 7:19414621-19414643
Sequence TTGGATCCACAGATTGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021336908_1021336913 24 Left 1021336908 7:19414574-19414596 CCAAACTGATGGCTCTACAGCCA No data
Right 1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG No data
1021336912_1021336913 -6 Left 1021336912 7:19414604-19414626 CCTACAGAAACATTTAATTGGAT No data
Right 1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG No data
1021336910_1021336913 4 Left 1021336910 7:19414594-19414616 CCAAGTGTGGCCTACAGAAACAT No data
Right 1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021336913 Original CRISPR TTGGATCCACAGATTGAATT AGG Intergenic
No off target data available for this crispr