ID: 1021337627

View in Genome Browser
Species Human (GRCh38)
Location 7:19422843-19422865
Sequence ATGTTATAATTGATGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021337625_1021337627 9 Left 1021337625 7:19422811-19422833 CCTGGCTGTAATATTTTATTATA No data
Right 1021337627 7:19422843-19422865 ATGTTATAATTGATGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021337627 Original CRISPR ATGTTATAATTGATGAAACT GGG Intergenic
No off target data available for this crispr