ID: 1021340237

View in Genome Browser
Species Human (GRCh38)
Location 7:19455750-19455772
Sequence GACTCTCCTTGGGTGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021340230_1021340237 15 Left 1021340230 7:19455712-19455734 CCATCAGGTGGGGGCAGGGTTAG 0: 57
1: 209
2: 291
3: 340
4: 444
Right 1021340237 7:19455750-19455772 GACTCTCCTTGGGTGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021340237 Original CRISPR GACTCTCCTTGGGTGGGGCT TGG Intergenic
No off target data available for this crispr