ID: 1021341199

View in Genome Browser
Species Human (GRCh38)
Location 7:19464372-19464394
Sequence CTTTATTAGCAGCATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021341195_1021341199 7 Left 1021341195 7:19464342-19464364 CCTTTATAAATTACTCAGTCTTG 0: 129
1: 1625
2: 2722
3: 4304
4: 3741
Right 1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG No data
1021341194_1021341199 28 Left 1021341194 7:19464321-19464343 CCGAGTTAACTAAACTTCTTTCC No data
Right 1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021341199 Original CRISPR CTTTATTAGCAGCATGAGGA CGG Intergenic
No off target data available for this crispr