ID: 1021342370

View in Genome Browser
Species Human (GRCh38)
Location 7:19480416-19480438
Sequence ACTCTAAATCTGTGTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021342370_1021342380 25 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342370_1021342373 -2 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342373 7:19480437-19480459 GTTCAAGAGCCCAGTGAGTGTGG No data
1021342370_1021342379 24 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342379 7:19480463-19480485 CACCACAGAGAGCCCCTGACAGG No data
1021342370_1021342374 -1 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342374 7:19480438-19480460 TTCAAGAGCCCAGTGAGTGTGGG No data
1021342370_1021342375 0 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342375 7:19480439-19480461 TCAAGAGCCCAGTGAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021342370 Original CRISPR ACTCTAAATCTGTGTTGGGA AGG (reversed) Intergenic
No off target data available for this crispr