ID: 1021342371

View in Genome Browser
Species Human (GRCh38)
Location 7:19480420-19480442
Sequence TTGAACTCTAAATCTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021342371_1021342379 20 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342379 7:19480463-19480485 CACCACAGAGAGCCCCTGACAGG No data
1021342371_1021342373 -6 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342373 7:19480437-19480459 GTTCAAGAGCCCAGTGAGTGTGG No data
1021342371_1021342374 -5 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342374 7:19480438-19480460 TTCAAGAGCCCAGTGAGTGTGGG No data
1021342371_1021342375 -4 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342375 7:19480439-19480461 TCAAGAGCCCAGTGAGTGTGGGG No data
1021342371_1021342380 21 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021342371 Original CRISPR TTGAACTCTAAATCTGTGTT GGG (reversed) Intergenic
No off target data available for this crispr