ID: 1021342376

View in Genome Browser
Species Human (GRCh38)
Location 7:19480446-19480468
Sequence GTGGTGGCCCCACACTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021342376_1021342384 7 Left 1021342376 7:19480446-19480468 CCCAGTGAGTGTGGGGCCACCAC No data
Right 1021342384 7:19480476-19480498 CCCTGACAGGGCAGTGCCAGTGG No data
1021342376_1021342380 -5 Left 1021342376 7:19480446-19480468 CCCAGTGAGTGTGGGGCCACCAC No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342376_1021342379 -6 Left 1021342376 7:19480446-19480468 CCCAGTGAGTGTGGGGCCACCAC No data
Right 1021342379 7:19480463-19480485 CACCACAGAGAGCCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021342376 Original CRISPR GTGGTGGCCCCACACTCACT GGG (reversed) Intergenic
No off target data available for this crispr