ID: 1021342380

View in Genome Browser
Species Human (GRCh38)
Location 7:19480464-19480486
Sequence ACCACAGAGAGCCCCTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021342371_1021342380 21 Left 1021342371 7:19480420-19480442 CCCAACACAGATTTAGAGTTCAA No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342377_1021342380 -6 Left 1021342377 7:19480447-19480469 CCAGTGAGTGTGGGGCCACCACA No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342369_1021342380 26 Left 1021342369 7:19480415-19480437 CCCTTCCCAACACAGATTTAGAG No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342376_1021342380 -5 Left 1021342376 7:19480446-19480468 CCCAGTGAGTGTGGGGCCACCAC No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342370_1021342380 25 Left 1021342370 7:19480416-19480438 CCTTCCCAACACAGATTTAGAGT No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data
1021342372_1021342380 20 Left 1021342372 7:19480421-19480443 CCAACACAGATTTAGAGTTCAAG No data
Right 1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021342380 Original CRISPR ACCACAGAGAGCCCCTGACA GGG Intergenic
No off target data available for this crispr